Description :
From Genome Similarity Track
Location :
contig_30:123164- 125552
Transcript NameFunction/comments
g5290.t1hypothetical protein

Sequence
2388 bases(100 bases per row)
CAGTCCAGCGCCCCCGCATCCACTCGCAACTGAACAAGTTGTTTGCTCCAATCAAGTTCATGGCGATAATTCACACCTACTCTACGCCAGCTTACGAGCG
GTAGTCGGCATTGATGGCCACGTACTCGTGCGTAAGGTCAATGCCCAGTACTTGAGTCTCCTCTGAACCAACGCCAAGGTCAATCTCCATCTAGTCCAAC
AATGAGAACAGAACAACGTTTAGAATAAGCAACCCATCAGAATACGAAAAGCGCTTACCTCGACAAACTTTCCGTGTGGCGGGAAGTTGTGCGAGCTGGC
ATCGAGGCCGCCACGAGTGGGCTCGATCAGCATCGCATCGCGCATGTGCTCCACAAGCTTGGCCTCAATCTCGTCGTTGAGCACCATCTCACCGTTCTCG
AAGATAATAACGCCACCCATGTGAATCTTCATGCGACGTGTGATATCCACGTCCTTGTGGTGCAAGCCCATGTACTTCCCCACCGCCATGACCAAACGGC
CCACGTTCGGGTCGTTGCCAGCGACGGCACACTTCAGGAGAGGCGAATTTACGACCGACTTGCCGACACCCTTCGCCATCTCCTTGGACAGAGCGCCACG
CACGCGCACCCGCATCACGTGGTGTGCACCCTCGCCGTTTCGCACAATATCCTCGCTGAGTCCCAGACACACCTCGTGCAGCGCCTTCTTGAACTCATCT
AGCTGGCTCATGTCGAAGGGGATTTGGTCCGAGGACACGAGAGTCACCGTGTCCGACGTGCTCTGGTCCGTGTCAATGCTGAGAGAGTTGTACGTGTCGC
CAACCACCTCCGTCAGCAGCTGACGCAGCACGTCACGCGGGATCGACAGATCTACATCAAAAGCCACAGAAAAGTCAGTACAAGTCGAACACGTTAATCC
TGAACAGCCAGGACGCACCGGTGAGGATGTAGGACAGCATCGTAGCCATGTTGGGCTCAATCATGCCAGCACCCTTGGCAATGCCGACGATGCGTCCGCC
GCACACGTCCATGGAGCGGATCTTCGGATACAAGTCTGTCAACAAGCAGCAAAACAATCAGTTAACAATCTACGAAACCTCTATAAAAACCAGCTAGTGC
TTACCTGTCGTCATGATTCCCTCGGCAGCAGGCAGCACCGAGTCGGACTGCAGGCTGTTGACGAGCTTGGGGAGGTTCTCCACCATGGCTTCCACGGGAA
TGCGCCATCCGATGACGCCCGTGGAGCAGGGCAGCACCTGAGCGCCGCCCTCCAGCCGCAGGTGCTTGGCCAGGCTCTCGCAGACCTCTTCGGCGTCTGC
AACGCCGCCGCCACTGGCGCACACGTTGGAGATCTTGTTGTTGACGAGGATGGCGCCCAGCGTGGGCTCGTGCAGCCGCTTGCGCCCCACGAGCACGGGC
GCCCCGGGGAAGGCGTTCTGCGTGAAGACGGCGGCGAAAAGCGACGTGGGTTGCACAGGCTGATGAGCGTCAAGGTCATGGTGGCCGGCAGGTGGGGCGC
CTCTCGCGGGATGAAGTCCAGCTTGGTGGTGCCCACGGAGAAGCCCCAGGGCAGGCGGCTTTGGTGCGTCTGCAGGTAGTCGGTGTATTCGTGGCGCGAT
TCGAATACGAACGGGTGGCCGTGGGTGGACAGGCAGCGAGCCTGCAGCAGCGCGCGCGGACGCGAGAGCGATGACATGCGAAGGAGCGACATGGCGACGA
ATGCACTCGGGGGGACGCCGCTTTTCGTCTTGTGGGCCAGTGAACCAAAGATCGCCAGATATTAGTCCAAGTACGTGGCCGATTGACGCAAAATTTGGCC
CCAACGTACCAAATCATATAATTTTGCTCCCATCGTCCAATATGATCGACGGAAACGAGTCGGAGGCCGGCTCGGACGCGCCGCCGCCACCTCCGCCGCC
TCCTCCTCCCCCAGTCGCGTCCTGCGCAGCCGCTCAAGCCCAAGAAGAAGAAGGACTTCCGAGAGATTCTAACGCTATTCCACGAGGAGGAACAGCCGGA
CGCCACCACGACCAAACGCGTCTGGGCGGCGCTGTGGCAGACGACGCTGGCGGAAGCGCAGGACGAGCACAAGCGGCGGCGGCAGCAGGAGCAGCACGGA
CTTAAGCGCAAGAAAGGGGGCGAGCATGACCATACGCCAATGAGAGGAGCGCCAGGATCGCTCTCGAGACACGGCAGCATGGTCCAGGACCACCTCAAAC
GAGCACGACAGGTGCAGATTCTATTGCTAAGCTTTCCGGGATTTTTAAACGCGTTTTTCACGAATTGTTGTGTTTTTAGGGCTCTTCGGCGAGCACGGAC
TCATCCGAGTCCATCAAGGCTGGGAGACTGGGCGGTAGGTTCCCCAAGAACGCCCCGAAGGGTCCAAACTCCTGCAGAAGTTTGGCGG