Description :
From Genome Similarity Track
Location :
Scaffold_11:123161- 126458
Sequence
3297 bases(100 bases per row)
CCATTAGTCTGTGGCCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATTTCTGCAAATGCTTGGAAAACCTCGCTCATGAAGCGTGGGTCGCGGT
CATGCCTTATTAATGATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAGCACTTGGGCAACACTCAGGGCAGTCGTATCTGACATAGCCTTGGCAAT
AACGAATCCCGTAAACGAGCACTGAAATAGGAGCAACGCCGTGTTGACCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAA
GGTCGTTCGGCTAGTACGTTGCCAGGCGAGTATCCACGAAGCTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCCCGT
CAGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTTCAGCGAGTCGTGACAGTTCTGCAA
GACCTCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTTCTCTTGCCAACTGTGGTCGTACAGACGATTCAGTCCAAGATAGTGAAGCACG
CCGTCTTCTGATAACACGAGCCGGTCAGCGTACTTCCAGGCATCTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGT
TAAACCACTTCTGCTCCTCGTCTTGTGCCACCATTATCCGTCTGCGTCGTTCCCGCTGTATCGCTACCGGGTCAACATCTTCCGCATCGGGAAATGCCGC
TGGTACAGTCTTGTGAGGGTGGTCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACGTCTCTCGTTGTTCTTCATGCTGTTCTTGAGCTTTTGAGACC
TCCTCCGAGTGTTCATCTGCAAACCTGACGCGTTTCTCGGCTTTCGTCTGTCGCCGAGTCATCACTGCCATATTACGATAATCGCACTTTGGTGAGCTGT
AATCAACCACGAAATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCACGTGACGAAACATCTACCGA
GTCTTCATCCGGTTCGTAGATCAATTCCTGAATGCGATTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATGACCCGACTGACCTTCGATTCC
AGCGCTTCAGTGGCTAACGAATCCGCGGCAGCGTTGTATTCTCGTACAACGTGAAGATACTTAACTGATCGAAGCTTGGTCGTGAGTTCCTTGTGAGTAT
TCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACC
GTGCGCAATAGCAGCCTTGACACCGTTAATCATCCCTGTGTACTCTGCCTCATTCACCGTGGTGCCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTC
CACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAAT
TACGGGAAAGCTTGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCTTTGTTTGGAGGTGCCACCGGCGCGAGCGAGTCTTCCAGGTCGAC
GAAGTTCGTGATGCTTGACTGCAGTAGCTGCGCGAAGGCGACATCCTTCTCCTTTACGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACTGCGAAC
TGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAAC
AGATCTTCAACATCAGAAGTAACGCCAAAACTTCCTTCTCGGCAGGATGGTAGTTCATCTCAGCCTCTTTGAGCACACGACCGAAAAACCGTACGGGGTG
TAACTTGCCTTCATGCTCCTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTGCTTTCGACCGATCGAAGTGCCTTAGG
ATGGGTGAATGTGAAACACTCGTCTTCAATTTTTCGAAGGAACGACGTGCCACAGAAAGGCCGCCTTCAACGGCAAAGTCCTCTTCCTTGAGCTAGTACA
GCACTGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTTAAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAG
CTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATACTCTTG
GTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGCCGCCAGGCAGCTGTCGAAATCTCGCCACCGAAGCAAATATCATC
CACAAACGACCGTCGACCAAACACAGGTACCAGCGATGATTCGTCCGGTTCCCCGTTCGTAAACATGTGAGCGACGGGGCTGTTGACGAGCTGTAGTACA
GGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAGCGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTA
AACGCATCTTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTAAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTT
TAACCCGAAGGGCATGTGTAACCACTCGAAATATCCGAGTGCGCAGACAAACGCCGACACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCG
CTTGCAGCATCCAGCGAGCAGAACCATAGGTAGCACTCAAGATCGGTCAACAGATCGTCGACTAGCGGCATTGCGTACTCCATGATGCGGTGATAGCATT
CACCATCTTGTAATCAATGCAAAGCCGGATGTCCTGCCCGTTCTTTTTCATCACAATCACGATCGGAGATGACCATGGACTGTCTGAAAAGACGATCAGT
CCTGCTCGCAACAGAGCGCGCAGCAGCTCATACAGCCTGCCGAGGAATCGTAACGGCACGCGTCGATCACGCAGTTTAATTGGGGCGTGCCCCTGCGTGT
CAATATCGCAGACTGCGCCGTAGGCGGGCGGCGGCAGTGCGTTACCACTAGCAATCATGATGTGCTCGTGACTCTTCAGCGTTGCGACCAGACGTTC