Description :
From Genome Similarity Track
Location :
scaffold_12:123147- 132493
Transcript NameFunction/comments
g770.t1 conserved hypothetical protein
g771.t1 hypothetical protein PHYSODRAFT_552366
g772.t1 hypothetical protein PHYSODRAFT_349212
g773.t1 conserved hypothetical protein
g774.t1hypothetical protein

Sequence
9346 bases(100 bases per row)
ATCTTGAGACCCTCCTTACTCGAGCTCATGAGTCCCAAAAGCGTGAAGTACTCGCGCAACATACGCCTTGAGACGTAATCCGGTGAAAACATACGCGCCT
TAAGGACTCCAATGTGTGACTCCACGATTGCAGCCTCAGGTCGTGCCTCCAGCTCCAATGCAGAAGAGATTTCTGTCAGTAATTGACCACGGCGATCAGT
CTTCAGGAAAAGCAAGCCTTCGGGGTGGTTCAACAGTAGCGTATACATTTGGCAGGCTGGACGCAAGTACGGCACGTGGTCCGGAATCCAGTACAGGTTG
GAGAAATAGCCCTTGTTGCCCTGATCGCACCGGAAAAAGCCTGAAAGACGCTTGAAGAACTTGGTTTTCATGGCCTCCGACAGTCGCTGCGGGTTTGTCA
ATGGACCCTCCAGCATTTCGGAAATGATATCCCAATTCCAGTTTTTGTAGTTTTTGTCTGTCAACACACGCGAGCGGTTGTGCAGCATGTCCTTAAACGT
ACTGTCGTCCATCTGAGCATCTAACGATTGCTTCAGTTCGAGAACCATCAGCTCTCGTGACGTTAAACTGTCCTTCAGTAGTGCAGTCGCACTCTTCGTG
CCACGCTGTGTAGAAGGAGCCGCCACCGCATAATTTGCAGATCCACTCCCAGTGCCAATGCCGCTACCGCCACTAGAAGACGGAAGACGTACCACGCCCG
CAATCTGCTGCAGGGCAAGTAGATTTGACGGTCGATTTGTGTCACGCAGAAGCTCCGATGCTAGCTGCACACCGTTAACACCACTTCCACCGTACGATAC
CAACGACACGCCACGCGTGGCGATGCTCCCTGAGTTTGCACCAACAGCATTAGCCAGTTCACCCAGCATTTCGCTAGCTCGAATTGATTTTTCTCGTTGC
AGACGCTCCAGCAGGCTCTTGGCATGGTCGCCAAGGGACATTGTGGTTGTCGTAGTAAGCGAAGTCGACGACACTAGCCGGGGGAGTGCTAGCAATGACG
CGCAGTGCTGGTCCGGCAGCAAACGTGAAGCCATACGTAAGATATCCGCAAGAAGGTCAATTGCCGGATCCGCCAATGCTCGAGACGGTCCCGTTCCCAA
AGTCACTAGCGCCTCAAGAATACCACAATGGATCATAGCTAGCAGGATAATCACCGTGTAATTGTCCAGCAAATTGTGGTTGACTGCGAGTGGCAATTGT
TCTGCACTGGACAAGCTAACGGGGAGAGCAGGTGTGTCCGCAGCAGCGTCAGCTGCTGATCTGTCAAAGCTCGTCTTCTTGTAAAAAATCTCGCAAATAG
TAGACAGCACCGCTTTCTGAACATCCTCTCCAACCGGCCGCACCAGTAACTGAATGAGCGACTGCAGACCCTGCGGGTTGCTCGTAAGCACCACCATTCC
CGTCCACGACCGCATCATAGTCACAATAGCATTCCGACTCGCCATCCACCGCTGCCTCCTCTCATTGCCCGCAGGTAAGTCCGTATCTGTAAACGGCGCC
AAAAGCACTTGAGAATCCACAAAAGGTTCAATAAATTTGCGTGTCGACGGCTCATTGAGAATCAACAGCAACGTCATCAGCAGCGAATCGGCCAAATCTT
GGAACGACGGCTCCAGAATGGCATCCACCAGGATCTTTATGCCATTGGCTTCTGCCACAACTTCCACATTCAATAGTGCAAGCTCCCGCAGCGTCTCCAA
GCAGACTCGACGCATGTTATCGTCCTTGTGGCCTGCAATGGCCGTCAACGAGCACACGAGGCCCGTGGGCATCTGCGCCGCGTCGATCTCCAAGATCCGT
CGAACAACTTTCAGCGCTTGGACACGCTCCGCCAGGTGCTTCTGCTCACGCTCCAGCGAACGCACCACAAATACCGGTAAATTGAGATCCACGAGGTGTT
TGATGCTGCTGCTGCTGCTGATAGCGTAGCGAAGAGCCCTGAGAGCTCCAGCACGTGTAGATGTGTCTGAATCGCACACCAGACGACGCATAGCCTTCAT
AAGACGCTCCATCGGGAAGCTGTCGAGCAGTAAGGGGTCATTTTTCAGTTCCTGTGGATCGGAAACGTTGTGCATTAGTTTTAATTTGCAGACAAGAGAC
TTCAAAATGGAACGCACGTAGCAGATGCGGCCTGTGCTGTCGAGCTTGGACTTGCGGTCCAGGTTGCTGCGCTCTATGAGCGTGCAGATGGCGGCCAAAC
TGCCATCACCGCGCGGGGCGGAGCCTCTGCGTTGCGACGCCATGCAGGGGGAAGATGCCGCAAGGTGCTACTGACTTTTTTGCCAACTTTTTGCGATGAA
AAATCCTAAATTTTATCTCAGTAAACGTGAATTTTCAGTTCTACTCGAATATTTTGGGTGGAAAGGGTCTTTCAAAAACTTATATAATTTCAGGTTGAAT
TGCGAAAAACCCATAAAACACTGTATATTATCTGTAGATTGGTCGTGCAACCTTACCTAGGAATAGACATGTGTAGGTAGGTTGAGCTACAAAAGACCCA
ATAAATATTTTGCATCGATATTTGTATGGCGAAAGCATTTTTGGGCAACAGCAAGAACGCATAATTGTGTAGATAACGCATAATTAAATCAGCCAGTAGA
CATGTGTAGATTTTTACCTATACTGGTTGCCAATCAGCGTTCGGAAGACATCATAGCTGCCTTTGGAAGGGTGTTTCAATTGACCGCACAACGCCATCCA
TCGAGAGCCGCACAGACAGACATCTTACAAGGGAGACTATGGCGACGGTGTCCATGAACCGACTGCTGCGCAGCGTGGCGGCGCTGAGTGTGTCCGCTCC
GCGCGCGAGTCTCGCACGCGCAGCCAGTACGCAGGCGGCCACGACGCCGTCCAACCTGTCCCTGGCTGACGAGAAGCCCATGCCCCCGCCCCGCGTGATC
GCCGCGGCGCAGCAAGTCAAGGTGACGCCGTTGGGCGACCTGGAGCTGCAGCTGCTGTCGCTCGCCGAGGGAGAACAGGAACTTGGCTCCGTCACCATGG
ACGGAGAAGTCTTCGGCGCTCCCGACCGTGTGGACATCCTGCAGCGCGTGGTGCGCTGGCAGCTGGCGTGCCGTCGCGCCGGCACCAACAAGACCAAGAC
GCGCTCCGAGGTCAGCGGATCCACGCGCAAGCCGTGGAAGCAGAAAGGATCTGGACGTGCCCGTGTTGGCGACATCCGCGCGCCGCAGTGGCGTGGAGGT
TACCGCGTGCACGGCCCCGTGCTGCGTGATTTCTCGTACAGCCTGCCCAAGAAGGTGCGCGCTATGGGACTGCGCGTGGCGCTGTCAACGAAGCTCCGTG
AGGGCAAGCTGGCCGTTGTGGACTCGCTGGACATTGACGTACGTAGCTGTTTGCAATTTTGCATTGTGGATGGGCTGTCTGTGCTGACATGTTGATGTTC
TTGTTGATGCGAACAGGTTACCAAGACGAAGGATATGAAGAAGCTGCTGGGCGGCCGTGGCTGGGACCACGCGTTGTTCGTGGGCGGCGAGGAAGTGGAG
TCGAGCTTCCAGCTGGCCACGCGCAACATCCCGTACGTGGACACGATCGCGCAGAACAAGATTAACGTCTACTCGATCCTGCAGAAGGACCTGTTGATCA
TCACGAAGGATGCCGTCAAGTACCTCGAAGAGCGTCTTCACGTCGACTAGAATGTAGCAGCAGTTCGACAGGTGGGCACGTACAGAAAGTCAGGAGGGCA
AGCGAGAAGGGGGTGGCCTTAGTCAAGTCACAGATAGAGTGTGGCCAATTTCGGGAAGCACCGGACGAATGCACTGGAGTTCCGCCCTGTTTCAATGTCC
TTACGCTTTTCATACTTAGATCGATGGTGCCTCGCTTAGATCAACCGTTGGGGTCAGCTCTGGGTGTTTAACGGTAGACCGCAGTCGTTCCTCAACAGGT
ATTGGCTCACTAACCTCAATGGCAGCGGAGTCGCAAGCGTTCAACAAATGTGCCTGGCCCAGAAACTCCTTGGCTTCAGTCAGCTCGACTGTCAGTGCCT
CTCGCTGCTTAGCCATCGCCTCCTCCAGCTCGTCTCGCTTGGCCTTGAAATCGCGGCCATTCGCCATCACCTTCATCAGCGTCTGCTTAATCAGACGACT
CTCGCGCTTGATCTCCGCTAAGTCGCTGGCGCTGGCACCGGCCCCAGGCTCGAACTCGCCCACGGCCATGCGCTCCAAGTGCCATCCGTTGAGGTCACCC
ATGCGGGCACTGGGGGCGCTCAGATCCAAAATCTCCCGGAAGTTGTCGACGTTGCGGCGTTGCTACACAAAAAGTAGTTCAGTTCGGTTCCGCTGGTGGT
GTATTGAGTGGGAAATCGTACGTCGTAGACTTCCGCGAGTTCCGTCCACTTGCCGTCCAAGTCATTGCGCGTATACAGGTCGCATAGCTCACAGATTGTC
GCCGCGGAGTTGGCGGCACCATCGTCCTTGCCTTTGCTTCTTGGCAGCATCTTTTGATACAAAAAAGATCGGACTAAATTTTGACATGCATATTTTTTGC
ATCTTCACTTTTACACATTTTCGCTGGGCGAAATGCGCTGCCACTATGAGGTGCTGGCTGTTGCGCGGGACGCGTCGGCGGTCGAGATCAAGAAGGCCTT
CCGAGTGCAGGCGCTGCGGTGGCACCCGGACAAGCATCAGCAGAACAAGATCTCGAGCGAGGAGGCCACGGAGCAGTTCCAGACCATTCAAAACGCCTAC
GAGGTGCTGAGTGACCCGCACGAGAAGAAATGGTACGACGAGCATCGCGAGCAGATTCTGCGTGGTGGAGATGGCAACGACGACGAAGAGGATGAGAACG
AGCTCAATTTGTTCCGGTACTTCAGCGCGTCTGTGTATTCCGGCTTCGGCTCGGACGAGAAGAGCTTCTACTGTGTGTATGGAGAGCTCTTCACCAAGGT
TAACTGGCTATCAAACAAGTTTTTGTTTGGTTTGTTGTGCTAATTGGCATTTGTGTGAGACAGATCGATGGACTGGATCTGGATGGTGGCGATGGTTCGA
ATGCTGGAGTTGCACCGGAGCTTGGAGATGCCAACACTTCGATGGATGATGTCAACTACTTCTACCAGCACTGGAAGAGCTACACATCGCAGCGCACCTT
TGCGTGGGTGGATGAGTACAAGACGACGGATGCACCGACGAGATTGGTGAGGCGAGCAATGGAAAAAGAGAACAAGAAGCTGCGAGATACTGCCAAGAAG
GCGTTTACTACGGAGGTGCGCGAACTCGTGGAGTTTGTGTATCGCCGCGACCCGCGTGTACGAGCCTTCCAGAAGCAAAAGGAGCAGGAGAAGGAGCAGC
GGCGTCTTGAGGAAGAGGCTAAGAAACGCGAAAAGCAAGCCGCGTTTGACGCTGAAAGACGTGCCTTTCAAGAGCAGCAGGAAAAGCTGTGGGCTGACAG
CAATTTGGAGACCAGTCGTGTTGCTGATAGAGATATTGAGCAAGAACTTGAGAAGCTCCGAAAGAAAATGGATGCGGGCGTGCTTGTGTGCGACTTGTGC
AGCAAGACATTCAAGTCCACGAAGCAGTTGCAGAACCACCTCACTTCGAAAAAGCACCGCGAGAAGGAGGAGGAGCTCGGTGTATTTAGCGACCTCAGCA
TGTTGGATGACGAGATGGATAGAGCTCTCCAGGAAGAGCTTATCGCACTTGGCAAGGTTAAGGTTGAGGCTACTGAGGAAGCACCTGCCAAGACAGCAGA
CGAAGAGGATGTTGATACTGAGCAACAAGAAGTTGATGAGGAGGCTGTACTTCAAAAAGCCAAAGCTGATCGTGTGCGGCTTGAAAAGGAACAGAAGGCT
GCTGAAAAGCGCCGGGAGCGCAAGGAGATGCGCAAAAACAAGAAAAAGGAGAACGTAGAGAAGATCGTCAGTGGTGCGCGCTCTAAGAAAGAGAAGAAGG
AAGAAGAAGAAGAAGAAGAGCAACGTGGTCGTGGCAAGAAAGGAAAGAAGCGGAGATAGATGACGCTGTCAGGATTCCTATAGACGCAATTGAGGTTTGC
TGAAGCAGTATTGAATTACATGGTTATGCGGACTGACTTCTTAGCGTTGTTGCACAGTTCTCGCATACAGGCATCCATTTAGACGCTGCACACTTGGTTA
CTGCTGGTGCTGTTCTGCACTCCGAACACTGTATGACGGCTTCTTCCGGTCTGTCAGCGGCAGATTTTGAGGCTGAACCCTGATCCTCCGTTGAAGGCTT
GTCGTGCATTCGCATTTGACTGAGTTCGCGCTCTTCTTTCCATCGCGAGACCCGAGCACGTTGTTGCTCCCGTCTCTCCTGGTCAAGCTTCTTCTTCAGT
GCAAGATCCCGCTGGACACGTTCTTGAAGTGTGTCGAAGTCGTTGTGGACTTGATCAAAAAGCCACTGAAGGCCTGCTTCAAGACGATCATCTACAACAC
CGCCGTAAACTGCTGGCTTGGCAACACAGGGGGCGATTTTGGAGCTTGGAAACTTGTTTAAACGCAGCAATTTCTGCATTTCGTGCTCTTGTATCGCGTC
GGAATGGTCTCGTTTGTTGGCGAAGCTGCCAGTTCACACAAGTTCGTCAGCGTGATTTCAAGTACCAAATTTCATTTTGTACGCACATTAGCAGCGGCTT
GTTGGTCATCAGTTCGTTTGCCATCGATTCCTCGAGTACATTCGCAGCCTGAAGCACCGCATTCTCGCTTGAGGAATCAACCACGAAGATAATACCATGG
GCCTGTACACGATCAAAACGTTCAGCTAAGTACGATGCAGTTGTGCAGCTTATTAGGCTATTGAAGTACTTACGTCGGCGTAGTATTCCTTCCATACGTT
GCGGAATGTTGGGCCTCCTCCAAGGTCGTAAAAAGTAGCGGACCCTGTTTCGGTCTCGAACGTGGCAGATGTGAAGCCTGCACTCGGAACGTGTTCTTTG
TCTAGATCGCCTTGTAACGTGGATAGAAGTGTGGTCTTCCCTGCTCCGTCAATTCCAATAATCAGCAGCACAATCGCCATTTTGCGGGTGATATTGGCTT
TTTCCTGGTTATCTTCAGGTTCTCCATTTTGTGTGGTTGCTTTATCGCTGGTTTCTTGTGTAGAGTGTAGCTTTAGACACATGACATGGACATTGCTCTC
TGTCTTCCCATCATCGTACAAGACGCTAAAACTACCGTTGTCATCGACAGCGGTGATGACGCCTGGAAAGAACCTAGGCCGGCCTTTATAACGACAAAGA
ACGCGGTCTTGGACGCTGAAGTGAACTTCAGCTTCGCGTTGGTTTGATGCTTTGTCAGAGTCGATAATGATTCGTGCTGCAACCACATCTCTGATAAAAG
CTTTGGAACAAAACACGGATTAGAATTTACGTAAATGTTACACCCCTTCTAGTCTCACCTTTGACGGAATTGGGTTTTTCGCGTAGAATCTGTTTGGCCA
GGTCATCCATGACGGGGATCACGCTAGTGGACATGAAGTCTGCCATCTTGCGGCGGTTAGTAAGCTTATTAGCGTAGCCAACGCTCCTCGTGTGGTGTGC
GAAGCGATTGGCTTTTTGTTCATCCACGAAATCATGGATGAAGTGGTAGACGCTTTCGGGCTGGTAGAGCAGCAACGACTCGATGAGTGGCATCAGGACG
GGGTCGACACATTGCCGAAGGTATTCGTGTTCACTCGCCGCAGCCTTGTGCGGTGTACCTGGACAGCAAAACGCGTGTAAGTCCCGCGAAAGGAATGACT
GCGTAAGGACAATGGCGCACTGGGGATCCTAGGCGTTGTCTTGGTAGCTTCACGCAGTCGTCGTGCGCTCATGTTGCAAAACGTTGACACCACTGGATGG
TGGCACTCAATACGCGGTAGTCAAGCGAGAGAGAGCGTCACCGGTTTGCAGCAGTGTAGCGAAAATAGCGTAGCCATCTTTAGAGTCGAAGATTGTTGAT
GCGCAACAACTGTTTCATGAAAATAGAATCAGTCCGAAATTAGAATTTTACCTAATTTAGGATATTAAGTCCTAATATCATGTGATGTACACAAATGATG
CAGCTTACCAGCGCGACGGTACACTGTATCCATGGAGGACTTCCCCTGCTGCGGCAGTGCTGCCCAGCCTGAGCACTACACTAACAATGCGTTGTGATCG
TAAAGACGCATGCCTATCCAGCCAATTCAGCGAAATACAGCACAGTGCGGTATCGTCAATTTCGAAGTGGCCGCTCGAAGATCGTCACACAAGCAGCAAG
TGAAAGTGCAGCGTCAGACAGCCGCGTCGCTCGCACGAAACCTTTCTTCCGAGCCGCACGATGGATGTCAGCTGTGGCCGTCACAGTGGTCGTGCCCCCG
CAAATGTTGATCGCGATTGTTTGATAGTCCGCAGCGAGCATCGTGGCGAAAATAGTCTTGCTAAAATATATCGTTGAAACATACCAATTTGCTGCAGAAA
CAGAAATCTTTTCGACTGGGAGTACTTTTCCATCACCACCACAACTGCTTACTGCAATAGCGCTGCTGCTCTTGTGGTAACGAGGTCATCATCACGAGCT
TCAACGGAACGAAACGCATGGATTCTACTCGGAACGATCTCCACAAGTACCAGAGCTTCAATCGAGCAACCGCTCCCCACGCAGCTTCGTATGTCTTTCA
AGCAAGCCCGACCTGAAGCTCAAAAATGGTTGCACCTGCAAACTAACAGTAAATAACGACCAGCGTTTCGAAGCATAGTGAACACAAGTCAAATGTTTAA
AGCGAAACGAATTTGTTATCAGGCGGCTTTTTCCACCAATCCCAACGGACATTGGGTTTTTCAACTGGCTTTACCCCCTGTTTATGCACACAAGCTGCCC
CAGCGCCGCACTGTGACATTCGGTCGTGGACCGACACAAGGCAGTGCCGCTCCATTACCCGCTCGCCGTCCGAGCGGATACGTGTGAGTCCCTGCGCCTC
AAAGCTTTCGCGTCGAGGAGCAAGTTCCATCCACTGTGTGCTGCTACTCTCGCTCGTGTTCAGCGCGAAATATCACGCGAATCACGTCGGTAGGAGGCCA
GTAGCAGTCGCTTCTCCACTTGCTAAAATGTCTGACTGAGATCTCTCTCTGCGTTGCTAACTAGGTTCCAGAGGCACAAGAGGCCCAACGTAGGGTGGGT
TTGGAATACAACACGGTGCAGAGTTTATATAAGCGAACGTAGCAGCAGGAACACGTGAAATGCACAGCGTTCGGGGTCTTGTGGCGGTTGTGGCAATGAG
CGTTACCAGTGTTAACGCTGCGGACAGCGTGTGCAGTCCACCGGAGCATAACACACTCACTAGCAATTGCTATGGAGCGTGTAGCTCGTCTCTCTGTGTG
AACTACGCGCCATCAACTGAGGAAGCCAGGAGCAAGGACAGCAGCG