Description :
From Genome Similarity Track
Location :
Scaffold_32:1231071- 1235495
Sequence
4424 bases(100 bases per row)
GGAAGCATATGATATGATCCTGGGCATGCCCTGGCCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCA
GTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGA
GTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACT
TAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATACCTGAAGA
GGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGATCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTG
GGTACAACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGAAGCCGTCGGC
AAAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCC
GGTGGAAGAGTGTTATCACATCTTCGATAGCGAGACGGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTG
AACCTCGATGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATCGCTGAGGATGGTTCTCATCCGACCTGAGACCACTCAGGAGGAG
CTGAACTCCTCCTCTGTCTTGGACGAGAGCGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATC
CGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGT
GCCCGGCACAAAGTATTGTGTCACGAGACAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATG
GTGCGGAAATCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTGGACCGAACGGAAAGTGGCGTCTGGTTCACGCGTATAACAAGCTGAACAACG
CAACGGTGCCGACCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATA
CTACCAAATCCTGATGCGAGAGACCGACATCCCGCTCACCGCGGTAACACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTA
ACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCTGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCAAAGCCGTGC
CGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTGCGTCGATTATTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGATAAGTGC
GTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGA
CGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAG
CCTCCTTCAGAAAAACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATTAAGACCAGTCTCCAAGCGGCCCCTGTCCTGGCCCTG
CCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCTGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACAGGAACGAGTCA
TCTCGTTCCAGCCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGCAATATGCCCTTGTGAAGTTCCGTGT
TCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAAAACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGG
CTGTCCTTCTCCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGG
CCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCATCAAGTTTCTTAAGGCCGG
AACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGCTGAAGGAGAGCCTCCTCTATTATCGGGTGGAGCCCACT
GATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGCTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAAA
AGACCTTTCTGTCGGTCTCTCTGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAATATGTCAGCGGGTCAAACC
CGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGGCTTGACTTCATCTTTGGGCTTCCCGCCGACGGA
CACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAACAAACCGCACGAT
TGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCGCTGCCGCGCTTTGGAAAACGCTGTTCCC
TTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACCGACGGCCTAACAGAGCGCGTTAACCGAGTGCTCGAGGACACTCTGCGCAGT
GTGTGCGCGGCAGCTCCACGTACGTGGTCGACGCAGCCCCCAGTTGTTGAGTTTGCGCTCAGCAACGCGGTGCACGCGTCCACGGGGCTTCCGCCACCCC
AGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAG
TTTCGCTGCGGAAACAGGTGGAATCCTATATGGATACCAAGCTGAACATTGTCAGCAGGGTTCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGA
GTACTCGGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTGCTAGCTCT
GTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCTTACACCATCGACCTTCCAAAGTCAATGACGA
CGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGCCCCCCCCCTGACCCAGCTCCTCGAAGCGAGG
GTCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCTTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATAC
GAACGGACCCCGGCACCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCGTACGCGTACGCCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCA
ACAAAGTCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTC
CACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAG
GACACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTAC
TCGTACGAGGGCACCTCCGCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGATCCTCAGGAGCAACGGTGTCGCGATAAGCGACAGCTC
CTCGTGAAGTGGAGGGGCTATGCC