Description :
From Genome Similarity Track
Location :
Scaffold_718:1231- 3431
Transcript NameFunction/comments
Phyta_totarag10345hypothetical protein

Sequence
2200 bases(100 bases per row)
TCAGACGGCGCTGACACGTAGTCCGACAGGTTGCAAATCTTCTCGATGCGTCCATTGTGCAAGTCGCGCgcgaagcgcttccagttcATAACTGGAAGCG
ACGTCAACTCCGACGCACTCGTTGGAGGGCTCTCAAGAGTAATACTCCTGTACTGAAGCCCAGTACNNNNNNNNNNNNNNNNNNNNNNNCCTTTCGGCGG
AGATTTCTGTCGAATCTGATCCAATCAGATTCGCGTCAGCTCCCGGAGCTGATTCGTCGCCGTCACAATGGCGGAATAAGCCTTTAAATCTAAGCTTATC
ATATTCTCAGTGTCGCTTCCCAGAACCGACACACATTAACTTCTAACGACTTCCGAAGTCGTCGGAGCTTCGCTCATTCTCGCAGGGCGCAAATGAGACA
ACAGCGTTTAGCACTGTCTCTACTGGAAGGTCGCATGCATCTCACGATGCATGTGTTGCGCTGACAGGGCCATCGCTCACTGTCGCGCTGTCGCAACCGA
AGGGTACAATcgtgcgcttcttccagtacATATTTGGGTCATGCCTTGCAAGCCACGGCAAGTCCAGAGCTAAgccgaacttgtcgtctaaATCGAAGAC
GATAAGATCGTCAACAAATTCCTTTTGTTGATACGAGAAGCGTACGCGTACGACACACTTCTCGGTcttcacgacggcacctgttgccagtcgtacttcc
aatATGCTTCGAGGAGTTTGCACCCCCTCGAAGTCGAGGTTTAGCAGACTTTGTATTCGAACAAAGTTGCTCGACAAACCGGAATCTACCAAAGCAGAAA
GAGAAGTCACGCCCAGGATGACAAGGTTTACCTTGGCATCTCGCCTGTTGCAGTGCGGTTGTCTCTCACTGGACTGCAGGCTTCAATGACGCGTGTCCGA
AGTCGACATGTGTGACTACTTCACCAGTAGGTTCCTCCGAACCTATTGGCTCCGGGCATTTTGTATTGATCACGATGATGCCTGGCATCGCCACGTTGAC
CACTTTGCCCATGCACAGCCGATGTGCATTCGCACGCAAAATGACCGATGCGTCCGCGATGCACGCATCGTACGTCAGCCCCATGACGTGGTGGGTTGCT
ACCAGCCGTCGCATTCGATAGGTCCATTGGCTCTGGCCATCCTGTCCTTACCATCGGACGTGGCATCCGTGGCACTTCACATGCAGTTTAGCCTGCCGCA
GGCTAAACTCTTCTTGCATTGCGAACGCGACCACAGCCTCGAGAGTACTCGGGTACCCTCGAAAGATACAGGTCTTCACCGGCCCATCCTTCAAGCcctt
catgaacgtgacgaccTTGGCCGCCTCGTCTATCGGGTTGGTCACGGTGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAACAGGGACGTCATGTTTA
ccctgctgcagatcgaggaaCGGTACCCTCACTCGGAACTCGCTTTACGGGGGCTCAACCGTTCGTCtgagcttctgcttgaaattctcgtacgtgctga
agcacaTAGGGTCTGCGAGTCAGCATCCGTATGCCCAACTCCTTGCTCGTCCTCCATGGCACGACATGGAGAACGCAACCTTCGACAAGGTATTGACGAT
ACGTCGAGCCGTGATAGCTGtgtcgacttcgacaagcCAACGGAGAAGAGGTTCGCCCTCTTCTCCCACGTAGTTGCTCATGTGGAGCTTCAGCGAATCG
ATCGCGGTGTCGTCGGGGATGACGCCGTCGTAGAGGCAGCAACATGTCGCTGCTCGTTAACGATAAAGCCCAGAGCAACACCGTGTTGCTCTGTAGGTGA
TAGCGGCAACAGCATTGCCGCTACAGCTGCCTCGCCAATGACTGTTAACAGTCGTTAGAGCGCCTCCCACTCTGGGTCCGACAGGTGGGGGCAGTCTGGA
CGCgcaatgtgcgttgcagGCTTTGTCCATCGGAAGGTTCTCTTGCCGCATGTTCATAAGGCCCAATACGAATGTGCAGTTAGTCGGTCGTTGGGCGGAC
TACgaagtgctaccaggtgtaaTTGGCCTACTTAGCCTAATACACGTGTCCGCACGTGTATGGGGAAGCGTAGGCTCTTTGACTTGGCTTTATCAGCGTC
ttgcaagtataattaaggCTAGATTAAAGACGATGATTAACAatttaggtgaaattgaaaactgtgttttatttgcttatGTGTCAGGGTTTACCTCCTA