Description :
From Genome Similarity Track
Location :
Scaffold_20:123085- 130181
Transcript NameFunction/comments
Phyke_g1281hypothetical protein
Phyke_g1282succinate semialdehyde dehydrogenase, mitochondrial precursor

Sequence
7096 bases(100 bases per row)
AGTATGTCGAGCAAGACTCTTCTGCAAGGCGATCCGCGTCGCCCAGGCGACTTACACCCGTTCGTGCGCGAGCAGGTGGACCCCGATGATGCCCCAGGAG
ACTGGTacgccttcttctcgctcgtCCTGGGCTTCCTGGCCTTCACCATGAAGGTATGACGTCAGTAGCATAGACACATTTTATCTCGGCTTCTATCCCC
TGAAGTTTGTACGCCCAATTTTGACGCAAATCTCTGTGTATTGATTCTGTTTGTAATAATCAGTGGAAGGAAATGGCGTGGggatcgctgctgctgtgcg
ttgGATCGTTCGTCAACATGAAGGCGGAGGACATGAACACGACGCAGATCGCCAtgtctttcttcttctccaccagtgcGCTTGTGTCTTCTTACATGGG
AACTATGCGTCCAGGGATGCCCATGCCACCATCAGCCCAATCTTCCCCTGCACCATAGTTTTGAGTAGTCTGGATTACCTGCAGGAACGAAGGGAGACAA
AGAGGGAGGACGACCAATAGGCAGCTCATGCCGAGAGGTGCTCGAGGATGTAAGAAATGCATGAACTGTATGGACTCCATCACAGGTTCCAAGTGTACTT
CTGTGTATTGGTGGTTGTGTTAGATATTGTTGTGTTCGAATAATGTTGTGATCAGCCGTGGATGGCATGACAACGTAACGGCGATGCCAGTAATAACGTT
AgggaactgctgcatcgttACCAAGGAATGACAATTGGGCGCCACGAGACGTATTCAGGGCGCTTTGGAGACGACGTGACGCGAACGAAGGACTCCCCTc
gagaagatggcgatgataCCCCACATATTGTCCACGACGTGACTGGCGGTGGGTTCCCCCAGAAGCTTATGAAGCGGCCACGGGGCCCACCGCTAGTCAA
GATACCTGCAAATGGAGCGCCAGGGACTCGAGTCTTGCCTCCCATCAGTGCAACTCGACCAACGAGTCTTGATGCACCTGGCACATCTTCCGTCATGACC
TTGGAGgagaaacagcagcgccaaaTGCACTCATTCCTACACAATTTTCTCGATAAGAGCGACAGTGGTCGATTCCAGCAGGTCATTGACCTACATCAGC
ATGGAATCGACACGGGTATCACGGTCACAGATGCGACTCTACAAGAGGTGGTGCTCGCTGTGCCAAATCTTCGCGGTTTAAACCTCTCTGGCTGTTCACA
CATCACTGATGCGGGACTCTGGGCCGTGGCCAGGCACTGCCAGTCACAATTGGATACAATTTATCTAGCGCAATGTGAACGAGTGACAGAGCTCGGCTTA
CGCCTTCTTGCCCACAACTGCAGACTTGTGCTGGTAGATCTCAGTGACTGTCCACAGCTCAATGATACCGCGCTGCAAACGATCGCCGCTGGTTGCTGGA
TGATTGAGACTTTTATTATGAAGCGATGCCGAGGTGTCTCTGACGCTGGCATCGTCAAAATTGCCCAGTGCTGCAAAGGCTTGCAGCATCTAGACGTGTC
GGAGTGTTTTCGACTCGGAGAGTATGGTGATAAGGCACTTCTTGAAATTGGCAAGTGCTGTCCGAAACTTCGTGTGCTGGACCTCTTCGGTTGCCAACAC
GTGCACGACCCAGGTGTTCGTGCCATCGCTAAGGGCTGTCCGTTATTGACCACGCTCAAGCTGACAGGGTGTCGTGATGTCAGCAGCGTCGCAATTCATG
CGCTGGCTCAGCAATGTACGCAACTGCGGATACTCTCACTCTCTGGATGCATCAAGACAACAAATACTGACCTTCAACTGCTTGCCATGAACTGTCCTCA
ACTTACTTGGCTCGACATCAGCGGCAGCCCGAATATTGATGCACGTGGTGTGCGTGCACTGGCGCAAAGCTGCACTTCTCTGGTGTATTTAAGTTTGGCT
GGGTGCCAGCGTGTGGGGGATGCAGCGTTAAGTGAACTTGCGACCGCAGGATTGACAAAGTCTTTGGGGGAATTGTCACTGGCTGATTGCCCTCGTGTCA
CGGAAAGTGGAGTTGATGCACTTACCACCGAATGCACCAATCTCATTACTCTTAATCTCACAAATTGCAAACAGATCGGCCGACGGTTTCTTCAGAAACT
CGTCTCGAAGCTTGTGTTCGTGCAGTGGGCTACCAGTTTCTTCGGCTACGAGCCATTACCGAATGCTGCCGAACTATGTCGACAGCGGGATCTCCGCTTA
CTGGAACTAAGAAGTACCGTCAAAATCCAGTCTGCGATGCGTGGCTGCCTCGCTCGTGGGGGACTGTGGCAAGCCAAGCTCAAATTCGTGGAGCGGAGGA
TTCTGCCTAAAATTCAGGCGCGTGTGCGTGGATTTTTGCTACGGAAGCGCCTCGCATCAGAGAAGCAATACCAGCTAGAAATTCACGCTGCTCAATTGAT
AGAGCGTGCTTATCGTGatttgcagcttcgacgCATGCTAGCCCGCGCGAAGCGAATACGCCAGATCAAGGAgcacgaagatgaagcagcactCATTTTC
CAGAAGATTTTCCGCGGCAATCGTGATCGCAAACGCGTGGCAAACTTGAAGTACGAAATGTACTGCGAGCAACAGTTTCAGGCACGTGTTGTTGCCATGC
AGAATATCGCAGCCACAAAGTTGCAGCGTGCTTTCCGCGGACATCGTGGGAGATCCGATGCTGCTTTGGCGCGCTCGGTGAAGGAGGCGAAGCGTCTTCA
GAGTGAGAGGGAAACTTGCTCAGCATCGTTTATTCAACGCGTGTTCAGAGGCCACAAGGGACGAAAGGTTCGTGCTCTACGGATTACTGAGCTACTCCAT
CAGCAACAATGCCACGATGGTGCTACTACGATGCAAAAGGTATTCCGTGGACATCGCGCGCGGCGAAATGCAGCAATTCTACGTACAGAGGTGAATGAGT
TGCGAATATTTAATGCCGCATTAACGATTCAACGGTATTGGCGAGGTATTCGCGATAAGCATTTGGCCGCCGTATTACTTGGCCTTGTCAAGCTCCGGGT
TAGAGAGAATGAGGCTGCATACTCTATCCAGGCAGCGTATCGGATGCACGCCTCGCGAGGACTCATGAAGGCAATGAAATTAGCATTGGCAGCGCAGATG
AGACGAATAAAGGCTGCAACAAATATTCAGCGGTTGGCGCGAGGATATCGTGGGCGGGCGGAGGCGGAACTTCTCCGAGAATTACAGCGCTTCCGGCACC
AAGCCAAGCCGCTCTTCGCGAAGGAAACTCGTTTGCAATCACTTGTGGATGATCTGAATGAGAAAGTGGAGCAAATGCAGAGAAAAAGTGCTGATGACGA
AGCTGAGGAGCGCGCTCtgacgctggagctcgaGAAAACGCTCCAAATTAAAACTAAATACCACGACTCGAGTCGAATTACAGGGACACCTCAACGCTAT
TTGACCCAGTATCTTCAGGTCCAACTTGCTGATCAGCTGCGAGCGAAGCGAACAGAAATTGCACTTGATGGACGGTCTTTTGAGACGCTGACGACAAAGT
TAGGCGACACACAGAAACAGTTGCGTGGCGTCAAGCGTGAACTGGAGCCACTGACAGAAGGTGTGATTaagaaaacaaaagaaaATCGTGTGAAAAGGCT
ACAAGACAAGGTACGGCATGAGCGTCGTGCAGCGATCATCATCCAAAGGATTTTCCGAGGATTTCGTGTACGCTCGGCAGTTCGAGAGGGCGGAAATTGC
TGGGTTGAAATGACAGAAGAGAATGGCCGACTTTACTTTTACAATGCACTGACAGGCTTCACACGGTGGCATAGACCCATGGCAATGGACATATTCGGAG
ATAAGTTTGCGCGACCGATGAATGAGCCCACATATGAAGCAACTCTGCCAATGCTGAGCAGTGGGCGTCCTACTACTagtcgcagcagcatctctgAGAA
GCAAAGCAGTCCAGAAGGCAAGCACCAGCCTACGTGTAATTGGTATGAAGCCTTCGATGACAAGCTTCAAGCTTCATACTACTTCAACAGTGAAACCAAG
GAATATCAGTGGGATAAGCCTGACGCTATCGACAACGCATATTTTACCGATAGCCAGACATCCCGACGGCGCAGAGAGTGGCttgatgagcagcagcaag
acatTGAGAACCTGTTAGCAAATACTCAAGTGCGGACACCTCTTCTAGGTCAATGGGAGAGGCGTGTCGATCCTCTTAGCGAGAACACCTTCTTTTATCA
CCCACCGACAGGAGCCATCAAAGCCTCGCTGTCCCCGCGTAGTGTACATGCTTCGTTCGGAGACACTGCTATGTGCTCGCGCCGCTCTGCCCGCAGCTTT
GGAACTTCTCGATCTCTCCATTGGCAGTATCGATACGGCTACGAATACGACACCAACGGAAACCTCGTGGTCAGCTCGCGATCACAACCACGCCCTATTT
GGACAGAGCACACGGATCCAGATAGCAGCATGACTTACTACTACAACGCTCTTACTAACGAATATCGGTGGGAAAAGCCTGGCGATTTCGATACGAACTA
CGAAATTTTTGCCAGCGGGAGGGGTGCAAGTAGCTCATCGCGACAATGGTTTGAAAtggctcagcaacagcttaCTGCTGACGGTACTAGCTCTCTGACG
GCTAGGTCGTTGAAAACACGCACCTTGGGCAAGAAGTGGGTCGAGTTGGTGGATCCAGCTACGCAGAACACGTACTACTACAATGAAGTGACGGGGGAGA
CGCGGTGGTCGCTCTCACCTCGTAGTGCACGCGACACTTCCGACACTGACGACCAGATCTCCTTGGCACTGCTCACGCTAGTTAAGCAACTCCGCGAATC
TCCTGTGCCATACTCTTCTCGGGGTCAACACATGGGTTGGCTtgaagctgccatcattgaAAAGGACTGGAACAAGGTCGACGCTATCGTTCAGCAGATC
TTCATCCGTGAGCAAAGCCAAGTTGCGACGGAACGCAACGCTAAAATCACTACTAAAGAATCGGCAGCATATCTGTCAATGGCCATATCGGGCTCTGGCG
GTGTTGTGAAGAGCAACGAGTCTGTGATTAACTCGTCTGAAGCCCACCCGAGTATAACCCAGAGTAATGCAGGCCTGGCCGAAAGTGTATGGCTCAAATG
TAGAGATGAAAGTAGCGGCGTGGCATACTACTTCAACCAATCTACCAGCGAAACGAGCTGGACCAACCCATCGGCTTTATCCAACACAGATGCTTGTCGA
TGGGAGATAGCTCATGATCGTGATGGCAAGGCGTACTACTACAACCCGGTGACTGGTGAGACGACATGGTCTGACCCGACATGAAGACGCAGTTGTTAGC
AAGACACATTGAGGTCATGAGCTATAACTTTATTCCAGTATACGTCTGGCTCACTAACCACACTATCACAAACTTGCGCACAAACTACCTTGTGCACGTT
TACATTTCCAGACCACCCACGCAGACCATTTTCGTCTCCTGGTACTCATCCATGCCCATGAACGAACCTTCGCGACCCAGTCCAGATTGCTTCACACCGC
CGAACGGCGCCTGCACATTCGAGATCACGCCCGTGTTAACGCCGATCATGCCGCAatccagagcagcagcgacacgCCACGTTCGGGACAGGTCCTGCGA
GAAGAAGTATCCAGCAAGACCTGCCTCCGTTCCGTTCGCCATCTCGATCACCTCCTCTTCGCTGGAGAACTTGAATAGCGGTACAATGGGTCCGAAGATC
TCCTCGCTCCACACACGCATCGTGTCGTCAACATGGGCTAGTACCGTGGCCTCGTAGAAGTTCCGCCCGATGTCGCTGCGCTTGCCGCCGACAAGAGCAG
TTGCGCCATTTGTCACGGCAtcctccacgagctccgaCGTCTTCAGGAAAGCGTTGGGGCCGATCAACGGACCAAGGCTCACTCCATCCTCTCGAGGCGG
AcccatcttcagcttcttcacgcgCTCTACCAGTTTGGCCGCGAACTCATCGTAAATGTTTGAGTGGATGAAGATACGGTTGCTGCACACGCACGTCTGC
CCAGTGTTGCGGAACTTGGACGCCATCAGACCGTCCAGAGCCTTATCAAGGTCGGCGTCCTCGAACACAATGAACGGGGCGTTGCCACCAAGCTCCAACG
ATACCCGCTTCACCGTCTCAGCCGACTGCTCCATCAAGAGTTTGCCCACACGAGTCGAACCTGTGAACGAGATTTTGCGCacgtcgtggctgctggtCAA
AGCGCCACCGACCTCAGCAGCCTTGTCGTTCGGAGACGGCACGACGTTAATGACACCAGCAGGGATGCCCACATCCTCTGCTAGCTTGGCCAGAGCCAAT
GCCGATAAGGGCGTCTCCGCTGCcggcttcaccacagccgtgcaaccagcagcaaggcaTGGCCCCAGTTTGCGCGTGATCATCGCCAGCGGGAAGTTCC
ACGGTGTCACGATGCCGCACACGCCCACAGGCTCCTTGATCGCCATGATGCGGTGGTCCGTCAAAGACGTCGACGGCAGGAAGCCGCTCGAGTGCATGAT
CTCGTGTGCGTAAAAGTCGATGAAACCGGCGGCGTAGGCCACCTCTCCCTTGGCCTCAGGCAGCGGCTTACCACTCTCCACGGACGCAATGACGGCCAGG
TCTTCGGTGTTCGCGACGATCGCAGCGTGCCACTTCTTTAGCAGCACGGAGCGTGCCGCTGGCGACGttttcttccacttcttctggGCCGCCAGAGCCG
CTGCGATGGCCTCGTTAGTTTCTACTTTGCCCATGTTGGCCACTCGCGCGACCTCCTTGTCTGTGGACGGATCGACGACGGCGAAGTGTTTGTTGGAGTG
AGCCTCGACCCACTTGCCGTCGATGAAGCCTTGCGACAGGATCAGTTCTTTGTTGCGCACCTCCGCGTGGAAGAAGCGTCGAGCCATCGAGGCGGACGGG
ATCGCGGAGCGGTGGATCTTGGATGACAGCATGGCGGCGGacttgcttgtgcttgtgctctTCGAGGCGTTTTCGGGAATGAGCGACTTGGATCCGAGCG
CAGTTTGTTTGACGCCTGACGTTGAAGAAGTGAGCGTGGTTTGacttggattttgtatgCCCGTGCGAGCGTACACACGCTCCGTGTACGCTCCCA