Description :
From Genome Similarity Track
Location :
Scaffold_17:123076- 126182
Transcript NameFunction/comments
Hyaar_Emoy2803050Folate-Biopterin Transporter (FBT) Family

Sequence
3106 bases(100 bases per row)
AGCATACCACCCAGTGACCCTGATATCCACGACAGTGACTGTAAATCATTGGCTCCATTCTTCGGGTCTCGTCTCGAGAATTCCACAACCCNNNNNNNNN
NTGTGGTGGATTCCGTGGCTCGTCACGCCCGTCGACCTCTTGCTGGAACTCCTGTGTAAGTTGTGAAGCAGACGCAGCTCGCGCCCGAGCAATGTCCTGG
AAGCCAAACATCGCACGGAGTACGTTGCGAAAGACGAACGCGAGGAGCAGCAGGATCATCAATGCAATCCAAGCAGCTACTTGACGACGCGCCTGTGCGG
CATGGTATTCGTCAATGTGCGCATAGCGATTCTTGAGGTGATACGGCAGCTCAAACTGCGAACGCTTGGGCCAAATGGACAGAAAGAGTTCGTGCAGGAT
CTGACTCACTGCTGTCGACGGATTCTTCATGTCGTCATTGATGCACACGAACTTGGTACGGCGAGCACGTGTGCCCATCATTTGCTTCCACGCAAACTTG
TAGTTGTCACTCAGCATGTGGAATGTCACTTCGGTCTCTGGCATCAGCTCCACCATCGATTCGTAGCGCACATTCTTGATCAGAGCATCTCGTACCTCAG
GGCATCGCTCAAGGTTTTCCAACGTGATGTGCGGAGTCAACGTCTCAGTAAGTCGAAGCGTTCCCTCGGCCGTCAAAGTCTCACGCGCCTTCTCGCGCTT
TTCTGGTTGCACACACTTGTGTACTTCCGCCACAAAGGCTTCGGGAGGTGTATCTCCGTGTGCCAGACTAGCAGCAGTCAACACCTCGTCCTCGTCCAGG
ACCCCGTTCCGGTTTGCGTCGATATATTCGTGCCAGACCTCTTCCAGCGTATGTGGATGGATCTTGGCACGATTGATCAAGTAGTGAAAGTACGAAAAGC
TGAACTGCATATCCTGCGGGTGTCGGAACCGGTGCGCCGACGTATCGTTCACCTCCTTCGTCCAGTAGTCCTTGATTTCACGAATCATCGACTTCTGCAG
CAAGAACGGCATGTGTGATGGTACACGGCGTCGATCAGACGTCGCGGGCTTGCCAAACACGCGATTATACAGTTTGTTCACAAAACGTAATGAATCCCCA
AACGTGTCCTTCGACAGGTGCACCTGTGCATTCTCTAGCGTCACCTCGTGCTTGTCCTCGCTTGCTGATACAGATGGTGGTCCACAAACGTCTGCGTACT
CAACTTCAGTCAGGCTGTCAGTGGTAGGCACCACATGTCCAATACCAAGGGCAAGCTTGATGTCCTCATAAAAGGAAGCCAATGTACCAAGAATCCCATC
TTTAGCACGAGCTTCACGGCCATCCTGCTCATGCTCCTTGTGTTGTGCCAGTCTTCGTCTCTGAGTCTCACATGCAAGTCGACGGCCGTCTGCTTCCTTA
TCCAGTTGATTCTGCACGTCCACCTCGCTAGCCTCCGTGTCGGACAGGCGCAGGACAGGCTCTTCATTTGGGTAGCAAGTTTGCGGCCGAACTCCAATGG
ACCGTGTGGTACTGTCAATACACTGGTCGAGCAGCTCCAGCAGCGCCGGGTCATCTCCCATGTAAGGCGTGTAAACCACTTTTGGCTTGGGCGGATGCAG
CAGAGCCCAAAGCGTTGGCTTGTGCACCATTTCCACTTGTTCGGAGTAGAAGTGCCCCATAGCCAATGCAAAACAATAGCGGTAGCGTGACGGGTCAGCG
TGGTTCGTGTCAAAGAAGCAGATATGTCCATCAGTCACCAGCGGGTCAACCTTCCCGCCCTCTTCCATTACAACGTCCGTTTCGCTACAAGTTGTGGCAG
CATTGTCCATGACCGAGCACATGCTATTATCTTCCATGCCTTGATACGTATCATCTGCATCGACCTTCTCTTCTTCATCTGCCTCCTCGTCCTCCTCGTT
TTCCTCATCAAGCTTACTGGTCGCCAGAAGCAAAGAGTGCGCATGAGGTGGCAGCATGCGCACCATAACGATAATACCCTTGTTATCACTGGCAAGACGA
CATTTAGCTATTTCGCTGTCTGCGTCATAGAATGCAGCTTCAGCGTTCCCGTTTACACTATCCAAGATTGCATTACGTTGCTTGCAAGTCTTTTCATCCC
GTGACTCTCCAGTAACATCGTCGGAAGAACAAATAGTGTCAGGCTGCATTTTCGTTCTATCAGATGAAGAGGCTCGGCTACTATCTACGATCACATCCAC
CTTTTCAGTTCCGTCACCAACTACGTTATCAGACGCACCCGGTACGTCTGTCGGATTCTCTATCGTCGGAATCCAGAGCTGACAAACGTCTTCATCGCGC
CAATTTATATCTTCTTCGTCATTGTGCAGGCGTACGTATGTATGCCATCCGAGGCTGAGAATATCTCCGTCGCTCAGTTCCTTTCCTGTTACATTGAACG
GCAGAAAAATCTCGACTGGTGGCGCATCGCCAAACAACTCTCCGTCAACGACAGCAGCATCCTTGTCCTCGACTGTCTCTGTCGTCATGGTATGCTCCAC
ATCGTCATCAGGAGACTGGATCGCAGTGCGAAAGGTAGCTTGCCGAAATTCGAAAGGCAGCCGAACACCGTTCGGCCGGATGCTTGTATTCTGAAATGTA
AACATACCTCCAGAAATGTTAAGAGTAGCAAGCTCCACTTGCGCAGGACCAAAAGACGGCTCAATGCGTTGTTCTCCTCGCACCATTAAGAACTTCAACT
CAACAGGGTTTTCCTCTGCGTCCTCACCAACAACTGATATCTGAACACTACTTGTCATCGGGTGGGCCTCGCTGTCACGGCCAAATACCAGTAGCAAGAC
CATTTCCGTCTCGTATACTGACGCGAAACGAATGAGTTTTTCATTATCATGAGCAGCACTCCAGATACTTCCATTCACGCCGAATGCATCCGTCAAGTTT
AGGTACGTAGAATTGACATCCAATGGCACATGTACAAGCGTGTGGCTTGTTGAAATATCCGCTGACCAAAGTTCCTGTACAAGTGGTGACAATCTTTCTT
CATCTTCCTCAGCGACACCCTGAGCTTGTGAATGGTGACCATGATCCTCTTTCTGCACTTTACAATCCCCTCCGTCGAACGCGCACGAACTGACATTGCA
AGGCTG