Description :
From Genome Similarity Track
Location :
scaffold_353:12306- 13839
Transcript NameFunction/comments
Pl_105732hypothetical protein PHYSODRAFT_469328
Pl_105733hypothetical protein PHYSODRAFT_552970

Sequence
1533 bases(100 bases per row)
CAACAGCATCCGCAGTCTCACTCTATCACTTTCTAGACCAAAGGAACCCATCATTGACGACTCTTATGACGATATTGAGCTTGGTGTCATGCCTCGAAGT
GCTCAAGCTCGAGCTTCGCATTCTTGACCATACTGGATTTACCCTACGTTTTAGAGCGTACATTAATGTTTAACTGCGGAAATAACCTTCAAATTAACTT
TTGACCAATCGACTGGCTCGGTGGCCACAGCCAAAGACAAATTGGCGCAATGCGGCTTACGGCGGACGTGATTCTGCATGCGCAGGTGTCCATTAACCCG
CTGCGCGAGCGCGAGTTGAGTCTTCGAGGTACTTCCCCGTGTGCTCGCTATGTTTTATTCACCGATTACTGACGAGGTTACAGGTTACAAGGCCCCCGCC
GTCGAGAACTTGGGCGTCACGCAGGTGCGTCGGGAGTCTTCGCATCTATCTTAATAGCGACTAACACTGCTGTATTACAGGATGGCTTCGACTGTATTGA
TCTTTCGGACAATGAGGTCAAGAAGCTAGAGAACTTCCCGCGTCTGCGTCGGCTCCGCATGTTGCTGCTACACAACAACCACGTGTCCAAGATCCAGGAG
AACCTGGCGGAAGCGATTCCCAACCTGGAGTTCCTCATGCTCACGAGCAACCGCATTGCGCAGTTGTCGGAGGTAGACCATCTCGCCTGTTTCTCTAAGC
TGGACACACTTTCGCTTAGTGGGAACCCCGTGACCAAGCGCAAGTACTACCGTGAGTATGTTATCTACAAACTGCCAAATTTGCACGTCCTCGACTTTCA
ACGGATCCGTCCTCGTGTAAGTATTACAGAGCAGTATATAGTGTCTAGTTGGAGCTGGTTGATAACGTTGTGTCGTGCAGGATCGCGAGGCTGCAGATGC
GTTTTTCAACTCGGTTGTTGGACAGAGATTCATGAAAGAGGCACACGGTGAAAGTGTGGCTGAATCAACACAGGCGATGAAGAAGGTCGCGATTACACAG
CACCAAGCAGCCCCTGCAGCGAGCGCGGTGCCTCCTCCACCACCACGTGCACGTAAGGAGGAACCTGTCAAGGCTGCATCCCCAAAGAAATCTGCACAGG
TGGAACCGATGGAGGAAACACCAGAGCCGAAAAAAGAAGCGCTTCCTGTGGACGTGGAAATGGAAGATGCCGATGAACAGACTGCTGTATCATACTCGCC
ACCAAAGCCGATTGAGCAGATGACTGTGAGTGTCTTGCGCGAGGAATTGAAGAAGCTAGGCCTGTCCATTAAAGGTTTGAAGGCGGAGCTGGTGAAGCGC
TTAAAAGAAGCTGCTGGAGAAGCATGAAGCCCTTGATCACCAACACAGTTAACCTCACCATCAGCAGCAGATAGGAGATAGAAAACACGACTCAATGACG
CAGAGCACGAAGATGCACACACCAATGCAAACAAGCAACTCCTCACAGCGCCGATGATTATTCTGAACCCCACTTTCTCACTTGTGTTTGGTAGTTCAAC
CAGACCACCGGTTTTTCTGCAAATAATTCGGCA