Description :
From Genome Similarity Track
Location :
contig_32:123059- 130425
Transcript NameFunction/comments
g7275.t1hypothetical protein
g7276.t1hypothetical protein

Sequence
7366 bases(100 bases per row)
TAACAGTAGAACACCAGAAGGTTCTGAAGCAAGCGCTCCCACAGTATTGGAAAATGGTGCTATTACTATTGACAGTGCCAGTCAGTGTAGACATGAGCTG
CATGTGTTGATTATACGATGACTGCGGATAGTCTTTGTGTTTTGTTTATCACATTACATCAACAATTTTGCCAACTCGGTTTTACAATCTAAACCCCACG
TTGTCGCAGGGCAAACGGCGACTACTATCAATTGTGTGGATCAATCCTATACAATATTCGTGAAGCTGCACGGCGACTCGTGAAACAGTTCTACGGCGGA
TCACTTGAATTACGTACACTCTGCGCGACTAGATGGAATTATATACCAGCTGCGTTGTCTCGTTTACTCATGGACAATCGGCTATCCAAATTCCCCACCG
CTAGTGCACGGCAACGTTGATTTCCCGACGAAACTTGTGCCGTTCAGTTTTGGAATAGTTTGAGAAGGCACAAGCTGTTATTTCGCCCCGTCATAAATGT
CGTACCAACTAGTGCATGGCGAACACCAGTAGATTTAGCAAAGACAGCATTTACCATGCTGATCCCGTCAATTTTGTTGAGGAATGCTGGTGCATTGCTG
TTTATGCTGGTGTACGCTCCGCATATGTGATGATGACATAGATTCATCTTCAACTAGCTTGTCCAAACTCGGAGCTGTCGTCACTGGTGTCGACTCTACA
CAACTACAGTCACGCAGATCCCGGCTAGTATCATGATGCTGAGACTCACTACTATTTAAGATAGGCTCACCAGGACAAATGTGTTGAGTCCTGTTTACGA
CAACTACAAGCCCCAAGAACAGCTCCCCCGGCTGCAATAAGTACAGGAGGGAGCTTCTCTCGTAGATTAACGCGTGTGTCCAGCTTGTAGATGGAGATTC
GCCCCGTTGTGCGTAAGAAGATTGTGATGGATCACAACCACGAGATCGGTGCAAAAATGCCAAGCACCATCCTAGATCAAGACTTGCAATCCCTGAAGAA
ATAGTGCAGCCGGTCACGATATTAAAACAAACTGGGGCGAAGAAGACATCGATTCACCAGTATATTTTAGAGAATTGTGACCGTTTGCCGACAAACCGAG
TGCTTCGGGCATTGAAGGAAAAACAATTTGTTAACATAACTCGGGTTGAACGATTAAAGGAATAAAATAAAGAATCCAGCGAGCAACATGATATTATAAT
AAGGACATTCACAGAAACTGTAGACAGAAAGATAAAATAGTTCATGTTTTTCTATTTTATGCTGGTTTACCTAACCATCCCCCCTCTTCTCTTTTTACTG
CTTCTGTTAGAGTGTTCATGCGTGCGTTGTAATGCAGACTCATCGCATGTGTGAATGTTTTCGTGCTTCTCTGAAGTTCTGTTGATCGACGATACCCACA
GCACTAACGAATCGAAGCACAAAGTGTTTTCGTTCATGGAACATAAACTCAGCAGACAGCTATTGAGGAATTTAAATTTCATCAACCTGGCTTCAATTTG
CGGTAGTAGTAGTGTCTCATACCAATACATTGGTCGGATGATATCCATCCGGCTTATCAAAACCTGGAACTCAATCGACAAAATATCCGCCGTACTCTTT
CTGATGTCTACCTTAAACATTTGCAGTGCTAAAGTCAAAGCATTACGAGCTAAACTTTCAGGACTAACGGAGATGCACTCGCACATCACGCGAAGCACGT
CAGCATCTACAGCTTGAACGAGGACAATGAGCCCCGATCAGCTGAGCCTGCTGGCGCTCCTCACGCAAGGCCTGCTAAGCCTCGGCACTCCACGCCCAGG
AACCTCCACCGTACAATAGCCACATATGAGGGCGGGACAGAAAGAGATGAGTGAGTCTCTGTCCCGCCAAACTGAAGAGGCCTTGGAGAGCCGACCACGC
GAAGAGGCAGAAATGAGTGGATCATTTCCCCACGCCAGCCCTTCCAGCTTGTCACCCATCATCATCATATTGCTGCAGCAGCCGCCACGAACCAGTCCAG
GTCCAGCTTTCGTCAAAGACGACTAAGCTGCCAATCGCCGGCGGCGACGATATGGGCGATGTCGTAGGTGCCAGTCTGTTGGTCTTGGACGCCCAACCGA
ACGACTCCTTCTCCGCAACACTCTTCGCCTCCTTGGGCTGCGACAGCCTCTGCGCCGCCAACTTCACAGCCTTACTCGCCAGCTTCACAGGCGGCGCCGC
CGATGACCAATTTCAATGTTGGCAATCCAATCACGCCGTCCACCGATTTTCGTTCCGCTAGTTCCGCTTTTATCGAACCTTGGGGCAGTCTACGTGGTTC
TGCAAAGTATTCTCTCCTGATGAAGTTTCTGATACTCCAATTCACCCTCTTGATGATATCCGGCGTTGGCCATGCATAGCGCGCCACGTACATCATCTTG
GGAACGATGACGGCTGCTGCGATTGCCGCCCTATGTTGCGCCGTATTCATTTTGCTTCCGCTAACGCTAGTCGCATTCTGAGCGCCCCCGTCGCTTTCCG
CCATGCTTCTTCGGTAGTATTCCCTCCTGGCCCCACGATGTGGCCAAAACTCGTGTGCTCGTGACTATCTATATCACCTATTTACAGCCCTTTCTTCCAT
ATACAGTGTCTCGCGCCGTTCTCACACTCTCCCAAGGCTGTTGACTGCAATCTTAGTTATTGCGTTGAACGCCGACATCTGTCTCGTATTCACAGATGTC
GAAACTCACACTGTGCTTCGTAACTTGCGTCAACCCGCTATATTGCATACAACAACTCGGATATGTGTTTTATAGCTTGAATTCGTAGGATCGTATTAGC
AAACTTTGATATCTTTTTTTAATGTCGTATCATGATGCTGCACCAATGATTTCTGTTGTAATTGGTTGGGATAAGTATGTACTCGGTGATGGATGTTGTT
AAGATCCTTGTGAGCTCGTCTGTGTTGACTGTGAATGAACAGTTGAGGACGATACCTATGTTTGATGGAGCCACCATCCATCAACCCCAGACAAATTTGC
AGTCACTGCAGATATTGTGTAGTCATCTAGGCAACCTCGGGCTGCAAGATCCAACGCATGTACCTGTTTACAAATACGAATCAAGAGATAGACCACCAAC
ATATTTGCTATTGGGTCTGCTGTATCGATTGAAACGTGAGATATATAGATTTGAACTTGTCTCCCATCTACTGGTTTTGCACGACTACAAAACAATGTGT
AGGCGAAACAGTGAAATCGGCTTTAGGAAGTCATTCAAGATCTTTATCTAGATTCCTCACAACTTGCATCACACGGTGCCAGTTTTTCATAATCTTCAAT
GAAGACGTACTGAAAACTCCAACACCAGTGAATGCGACATGCACCGCGCGCAGGTGTGAGGAGTGCGCAGAGAACTTGGTGGTCGGCCGATCCGTGAAGC
CATTGGTACATGAGACCGTGCTGGTCACAGTCGCCAAGGTCGCTGTAGTGGCAGGTGAAAGGCAGAGCTAGTAGATTCCGTCGTGGCATCGTTCCAGCAG
CAGAGGTGGTCCATCGAGGTGGCAATGGTCGTCGTAGCAGCAGAACCAGTGGAGGGTCAGAGACTAGCGGTGACGGGTTCGCTAACTCCTTGGGTGGAAT
CCACTGGCGAATGCATTTTGTCAAGTCGAGCACTTGAACGACCCCGCTAAGGCTCTCGACCGACTGCGCTCGTACGACGTTCTTATATTTCCAACTCTTT
TCCCGCATGGGCGAGCACACCATCGTTGAGCCGATGGCGATGAGCGCTATGGTAGTAAGCAAATGGGCTCTCACGAGTAAAATGGTTGCGAGAACGGCAG
GCGACAGTTTCTAGGAGTACGGACCACCACAGTGTGGTGGATGCCGCATTCACAACTGACGCGAATGAAGCCACGTTGGGCGGATAACGAAGGAAAGAAT
ACAAACACATGATTAGGATGCAATGAGAGAAGGGGGCGTCCGCCGCACAGGTCCTGATAGAACGGAAGTTAAAACACAGCCCCCCGGCCATCGCAGAGGC
TCTAACAAACCTGTCGTGGAAACAAGGATACAGGATGGGATGGGGCACGGCGTATGTGGTAAATACCGCTATTGTAGGTATTTTAATAAAAGATGAAGTG
TATTGAGTTACTGCTCCCTACTGCTCGCTGAACTCTAATAACCATCTCACGTTGGTGTGTGCACTCTACGCAGTATTGATCGCCAGATTCTCTCCGCCGG
CCATACTGTCATCCCTTCTCTCCGAATGACTTCTCGCCTTCAGTGCTGCTGCTCATCCTCCCTCTTTTGCATCCTCGTTTTCGTGCCCTGTTGTCTTCTA
TTCATTTCTGTACGTTTCCTGTGAGTTGTTACCCCCCCCTCCGCACCTCTGTATATTCCTCTGCATCACTCCACATCTGTGTCGTACCTGTGTTTCTGTA
CATTGCGTAGTTCGCTAGTCAGTCGGCTGACTTGTTATGCTGTCGATAATAGTGCTCCCAGCTCTGGACTTCGTGCTTGTCTGCTAACCTTCTTGCTAGC
CGGTATCAGTTCGCGCCTTCGGCATTCTCTCTCTCTCTCTCTCTCTCTCTCCCTGCATCATGCCCAGGATGAGGGCACTGTCCCCCACCTCTTGTATTCC
CTCCCAGTGCTGGTCAACTGCTTCACCAGGAGTCTGTGAAGGCCTACGAATTCCACCATATTATTGGTAGTGGGTCTGTTACTAAGGGGTGTGGCCGCAG
CCCACACAGCTTTCGAGCCCCTTTCGTTACGGTTAGCTTGAAGCTATATCGTATGCGGAACTGATCAGAGATATGATCAGACAGCTGTTTTTTGGTGATC
TGATGTGGGATCTGAAAACGAGTGGTGAGTAAAGAAATAGTCTTTACTGAAGGTTTGCTTTGGTGCGTGCGTTGCTCAGTCGGGAAGTTGCATCAAGGGA
CCTATGTGGAGATGTTGACGGAGGGTGGTGAAGGTGACGACCCAGCTGCAGACCATGCAGACACAGAGCATGCAGCGGCAGACATGCACGCGACGGGCTA
CGACACCATCACGAACATGGTGACTGGCAACGAATACTTGGACTTGCAGAGTGACCAAACCCGACAGCACGATGAAAGTGGAGTAAGCTCTACACCAACG
CGCACGGGCCGTACAACTTGCTTCTACAGAGGCTACAAGTATACACGTGCGTGGGCGTCCATGATGAAGACTGTGTATCGCTGTTCAAAGTTTCGTCAAG
GCTGCCCGGGAAAGCTGGAGTTCAAGATTGCTTCGATGGGTTACTCATGCGTCAAGGCCCACACGTGTTGCACCGCAGTTGTTGCAAGCTCCGTGAGAGA
CATCAGGGACGAGATGGGATCTCAAGCTGACCTCCTGGCAATTGAGCACGTTGCATGGCCTGCGAGGCAGGTTTGGGAGACGTTACGGGATCGCTACTAC
AATGAAGAGAACCCTGATGTTGTTCGTGGACTGTCACAACAACAGGTGGTGCAGCGTGTGTACCGCGCGAGACGTCAACACTACGCTGGCAATGTTCATG
GCTCGATCGAGATCCCCCCGCTATCATTAGCACTTGGTGAAGCAGTGCCCTTTTTTCAGTTTCACTACACAACCATACATCGTGACGATTATAACAAGCC
AACACGCCTTCTTGGATGTGCGCATCTTTCGCTTGTTGCATTGCTTCGCTACCATGGTACTACGCTATTTGTCGATGGGACCTTTAGCTGTGTCCCAAGC
GGCTACGCCCAATGCGTGGTGTTCATGGTTCACGACCGCGCTTCAGGCGTGTTTGTTCCAGTGTTTTACATTCTCAGCACCTCACGGACTGCAGATTCGT
ACTGGGACATAGTCCATTTTGTTGTGCAAGCCACAGACCAGCAGATTAGTCCCGCTGAGATAGTCTGTGATTTTGAGGCTGGGCTAATGGACGCTCTTCA
AACGCAGTTCCCGAACGCTATCGTGTTGGGGTGTCTGTTCCATCTGAAACAGGCACTATGAAACGCATCGCGATTCCAGAGGAAGAGTGTACCATTGCGA
TGACGCGTGGCATTTTAGACGTGCTGACTGTCATTAAGCCAGATCGGGTCGAAAGAGGCATTAAGTGGGTTAAGCGTGAGATCAAGCGGCGTTGTGCTGA
AGCTGGGAATGTCTACTCTACTGACAAGTGGGGTGAATCCTGGACTGACTTTAATCGCACTTGGATTGAGCAGTACTCTATCGACCTGTGGAATGTGTTC
AGTCTGGATAATGAGCTGATTGCGCGGACAAATAACCCGTTGGAGAGATTCAACAGGAAGCTCAGTAGCCGATTCCCGGTGCTGCACCCCTCGATGGCGA
CTTTCGTAACGGTGATTAAGACGATCTCAGCTGAGTACATTCGCCGCGTTGCTGATGCTCCTCGTGGTCAAAATGCCCTTCACCAACCGTATGATAGCGA
AATTGAAACTCAACAGGTTGTGGTTGTGAGGAGGGAAGGAACAAGGATATGGAAATACGGCGGAGGGATGAGGAGAGAAGGTTCACCGAGGGGAAACTAA
TTTGATGTGGGCGTGTCCGGAATCGCAGGTACTCTGTATGGCCATGCTCGCAATGTGGGGGCGAGACAACCAAACAAGGCCTGGCTAAAAAGCAATTGCG
TGCTGCTGGGTTTCGAACAATTCATCGGAGCCCCTACGTTCGGCTTACTTGACAAGAGATGGTATAATATTTGCTACAGCTAAATCACAGTCGTTGCAGA
ACACCAGTGGTTCACTTCTTGATTTTGTCCTTCTCTCGAAGCAAGTTAAATAGTTTTTTAAGCCAATCGTCATCTTCCGAGTTAAGTTGATCATTTATAA
TATTTTTGTGACTGAGATGAAAGATACTAAGCGTAGCTGGTCGGTTCCCTCGAGCCTTCAATTCAGCGTCGATCGAAGCAAGATCTCTCTCGACTGCACG
AAAGTAATGTTTCCTCAGCTTCAAGCTTGAGTTATCAAGCTTCTGAACTGAGGCATTGTAAAGATCAGTAGCCACCGCGGTACAATCCTTCCACTAATAT
AGCTTATTGTTCAGTGCTAGCTGTTCACTGTATAATTGAAACTCATTCTATGAAAGTTCGACGTCGTGTCATGACTTGTTAAGGCAACGCAGATCTTCGA
TTTCTTTTCTAAGTACTCGTTTGTTGAAGTGTCACGTTCCTAGCACGGTTCACGGGAGTTCGGACCGCAGGAACGGTTCACTTTGAACCGTTCTCTGATT
TGCTGAGTAAACTTCGGTGGTTGTGAGGACACCACAAGAGGACAACAAGGGGGGACACTAGGGAGTATCGTAAGAAAGACATTTAAATCAAACTAATCTA
CTCACTTCGGCATTTGCCTCCAACCACAAACCAACAGGTTAACAGCCGCAGCTCGGTACGCTGCCC