Description :
From Genome Similarity Track
Location :
contig_32:123058- 130424
Transcript NameFunction/comments
g7625.t1hypothetical protein

Sequence
7366 bases(100 bases per row)
AAACAATAACAGTAGAACACCAGAAGGTTCTGAAGCAAGCGCTCCCACAGTATTGGAAAATGGTGCTATTACTATTGACAGTGCCGGTCAGTGTAGACAT
GAGCTGCATGTGTTGGTTATACGATGACTGCGGATAGTCTTTGTGTTTTGTTTACCACATTACATCAACAATTTTGCCAACTCGGTTTTACAATCTAAAC
CCCACGTTGTCGCAGGTCAAACGGCTACTACTGCCAAGTGTGTTGATCAATCCTATACAATATTCGTGAAGCTGCACGGCGATTCGTGAAACAGTTCTAC
GGCGGATCACTTGAATTACGTACACTTTGCGCAACAAGATGGAAGTAAATACCAGCTGCGTTGTCTCGTTTACTCGTGGACAATCGGCTATCCAAATTCT
TCACCGCTAGAGTACGGCAACGTTGATTTCCCGACGAAACTTGTGCCGCTCAGTTTTGGAATAGTTTGAGAAGGCACAAGCTGTTATTTCGCCCCGTCAT
AAATGTCGTACCGACTAGTGCATGGCGAACACCAGTAGATTTAGCAAAGACAGCATTTATCATGCTGATCTCGTCAATTTTGTTGAGGAATGCTGGTGCA
GTGCTGTTTATGCTGGTGTACGCTCCGTAGATGTGATGATGACATAGATTCATCTTCAACTAGCTTGTCCAAACTCGGAGCTGTCGTCACTGGTGTCGAC
TCTACACAACTACAGTCACGCAGATCCCGGCTAGCATCATGATGCTGAGACTCACTACGATTTAAGATAGGCTCACCAGGACAAATGTGTTGAGTCCTGT
TTACGACAACTACAAGCCCCAAGAACAGCTCCCCCGGCTGCCATAAGTACAGGAGGGAGCCTCTCTCGTAGATTAACGCGTGTGTCCAGCTTGTAGATGG
AGATTCGCCCCGTTGTGCGTAAGAAGATTGTGATGGATCGCAACCACGCGATCGGTACAAAAATGCCAAGCACCATCCTAGATCAAGACTTGCAATCCCT
GAAGAAATAGTGCAGCCGGTCACGATATTAAAACAAACTGGGGCGAAGAAGACATCGATTCACCAGTATATTTTAGAGAATTGTGACCGTTTGCCGACAA
ACCGAGTGCTTCGGGCATTGAAGGAAAAACAATTTGTTAACATAACTCGGGTTGAACGATTAAAGGAATAAAATAAAGAATCCAGCGAGCAACATGATAT
TATAATAAGGACATTCACAGAAACTGTAGACAGCAAAATAAAATAGTTCATGTTTTTCTATTTTATGCTGGTTTACCTAACCATCCCCCCTCTTCTCTTT
ATACTGCTTCTGTTAGAGTGTTCATCCGTGCGTTGTAATGAAGACTCATCGCATGTGTGAATGTTTTCGTGCTTCTCTGAAGTTCTGTTGATCGACGCTA
CCCACGGCACTAACGAATCGAAGCACAAAGTGTTTTCGTTCATGGTACATAAACTCAGCAGACAGCTATTGAGGAATTTAAATTTCATCAACCTGACTTC
AATTTGCGGTAGTAGTAGTGTCTCATGCCAATACATTGGTCGGATGATATCCATCCGGCTTATCAAAACCTGGAACTCAATCGACAAAAAATCCACCGTA
CTCTTTCTGATGTCTACCTTAAACATTTGTAGTGCTAAAGTCACAGCATTACGAGCTAAACTTTCAGGACTAACGGAGATGCACTCGCACATCACGCGAA
GCACGCCAGCATCTACAGCTTGAACGAGGACAATGAGCCCCGATCAGCTGAGCCTGCTGGCGCTCCTCACGCAAGGCCTGCTAAGCCTCGGCACTCCACG
CCCAGGAACCTCCACCGTACAATAGCCACATATGAGCGCGGGACAGAAAGAGATGAGTGAGTCTCTGTCCCGCCAAACTGAAGAGGCCTTGGAGAGCCGA
CCACGCGAAGAGGCAGAAATGAGTGGATCATTTCCCCACGCCAGCCCTTCCAGCTTGTCACCCATCATCATCATATTGCTGCAGCAGCCGCCACGAACCC
GTCCAGGTCCAGCTTTCGTCAAAGACGACTAAGCTGCCAATCGCCGGCGGCGACGATGTGGGCGATGTCGTAGGTGCCAGTCTGTTGGTCTTGGACGCCC
AACCGAACGACTCCTTCTTCGCAACACTCTTCGCCTCCTTGGGCTGCGACAGCCTCTGCGCCGCCAACTTCACAGCCTTACTCGTCAGCTTCACAGGCGG
CGCCGCCGATGATCAATTTCAATGTTGGCAATCCAATCACGCCGTCCACCGATTTCCGTTCCGCTAGTTCCGCTTTTATCGAACCTTGGGGCAGTCTACG
TGGTTCTGCAAAGTATTCTCTCTTGACGAAGTTTCTGATACTACAATTCGCCCTCTTGATGATATCTGGCGTTGGCCATGCATAGCGCGCCACGTACATC
ATCTTGGGAACGATGACGGCTGCTGCGATTGCCGCTCTATGTTGCGCCGTATTCATTTTGCTTCCGCTAACGCTAGTCGCATTCTGAGCGCCCCCGTCGC
TTTCCGCCATGCTTCTTCGGTAGTATTCCCTCCTCGCCCCACGATGTGGCCAAAACTCGTGTGCTCGTGACTATCTACATCACCTATTCACAGCCCTTTC
TTCCATATACAGTGTCTCGCGCCGTTCTCGCACTCTCCCAAGGCTGTTGACTGCAATCGTAGTTATTGCGTTGAACGCCGACGTCTGTCTCGTATTCACA
GATGTCGAAACTCATACTGTGCTTCGTAACTTGCGTCAACCCGCTATCTTGTATACAACAACTCGGATATGTGTTTTATAGCTTGAATTCATAGGATCGT
ATTAGCAAACTTTGATATCTTTTTTTAATGTCGTATCATGATGCTGCACCAATGATTTCTGTTGTAATTGGTTGGGATAAGTATGTACTCGGTGATGGAT
GTTGTTAAGATCCTTGTGAGCTCGTCTGTGTTGACTGTGAATGAACCGTTGAGGACGATACCTATGTTTGATGGAGCCACCATCCATCAACCCCAGACAA
ATTTGCAGTCACTGCAGATATTGTGTAGTCATCTAGGCAACCTCGGGCTGCAAGATCCAACGCATGTACCTGTTTACAAATACGAATCAAGAGATAGACC
AGCAACATATTTGCTATTGGGTCTGCTGTATCGATTGACATGTGAGATATATAGATTTGAACTTGTCTCCCATCTACTGGTTTTGCACGACTACAAAACG
ATGTGTAGGCGAAACAGTGAAATCGGCTTTAGGAAGTCATTCAAGATCTTTATCTAGATTCCTCACAACTTGCATCACACGGTGCCAGTTTTTCATAATC
TTCAATGAAGACGTACTGAAAACTCCAACACCAGTGAATGCGACATGCATCGCGCGCAGGTGTGAGGAGTGCGCAGAGAACTTGGTGGTCAGCCGATCCG
CGAAGCCATTGGTACATGAGACCGTGCTGGTCACAGTCGCCAAGGTCGCTGTAGTGGCAGGTGAAAGGCAATGCTAGTAGATTCCGTCGTGGCATCATTC
CAGCAGCAGAGGTGGTCCATCGAGGTGGCAATGGTCGTCGTAGCAGCAGAACCAGTGGAGGGTCAGAGACTAGCGGTGACGGGTTCGCTAACTCCTTGGG
TGGAATCCAGTGGCGAATGCATTTTGTCAAGTCGAGCATTTGAACGACCCCGCTAAGGCTCTCGACCGACTGCGCTCGTACGACGTTCTTACATTTCCAA
CTCTTTTCCCGCGTGGGCGAGCACAGCATCATTGGGCCGATGGCGATGAGCACTATGGTAGTAAGCAAATGGGCTCTTACGAGTAAAATGGTTGCGAGAA
CGGCAGGCGACAGTTTCTAGGAGTACGGACCACCACAGTGTGGTGGATGCCGCATTCACAACTGACGCGAATGAAGCCACGTTGGGCGGATAACGAAGGA
AAGAATACAAACACATGATTAGGATGCAATGAGAGAAGGGGGCGTCCGCCGCACAGATCCTGATAGAACGGAAGTTAAAACACAGCCCCCCGGCCATCGC
AGAGGCTCTAACAAACCTGTCGTGGAAACAAGGATACAGGATGGGATGGGGCACGGCGTATGTGGTAAATACCGCTATTGTAGGTATTTTAATAAAAGAT
GAAGTGTATTGAGTTACTGCTCCCTACTGCTCGCTGAACTCTGATAACCATCTCACGTTGGTGTGTGCACTCTACGCAGTATTGATCGCCAGATTCTCTC
CGCCGGCCATACTGTCATCCCTTCTCTCCGAATGCCTTCTCGCCTTCAGTGCTGCTGCTCATCCTCCCTCTTTTGCATCCTCATTCTCGTGCCCTGCTGT
CTTCTACTCATTTCTGTACGTTTCCTGTGAGTTGTTACCCCCCCCTCCGCACCTCTGTATATTCCTCTGCATCACTCCACATCTGTGTCGTACCTGTGTT
TCTGTACATTGCGTACTTCGCTAGTCAGTCGGCTGACTTATTATGCTGTCGATAATAGTGCTCCCAGCTCTGGACTTCGCGCTTGTCTGCTAGCCTTCTT
GCTAGCCGGTATCAGTTCGCGCCTTCGGCATTCTCTCTCTCTCTCTCTCTCTCTCTCCCTGCATCATGCCCAGGATGAGGGTACTGTCCCCCACCTCTTG
TATTCCCTCCCAGTGCTGGTCAACTGCTTCACCAGGAGTCTGTGAAGGCCTACGAATTCCACCATATTATTGGTAGTGGATCTGTTACTAAGGGGTGTGG
CCGCAGCCCACACAGCTTTCGAGCCCCTTTCGTTACGGTTAGCTTGAAGCTATATCGTATGCGGAACTGATCAGAGATATGATCAGACAGCTGCTTTTTG
GTGATCTGATGTGGGATCTGAAAACGAGTGATGAGTAAAGAAAGAGTCTTTACTGAAGGTTTGCTTTGGTACGTGCGTTGCTCAGTCGGGAAGTTGCATC
AAGGGACCTATGTGGAGATGTTAACGGAGGGTGGTGAAGGTGACGACCCAGCTGCAGACCATGCAGACACAGAGCATGCAGCGGCAGACATGCACGCGAC
GAGCTACGACACCATCACGAACATGGTGACTGGCAACGAATACTTGGACTTGCAGAGTGACCAAACCCGACAGCACGATGAACGTGGAGTAAGCTCTACA
CCAACGCGCACGGGCCGTACAACTTGCTTCTACAGAGGCTACAAGTACACACGTGCGTGGGCGTCCATGATGAAGACTGTGTATCGCTGCTCAAAGTTTC
GTCAAGGCTGCCCGGGAAAGCTGAAGTTCAAGATTGCTTCCATGGGTTACTCATGCGTCAAGGCCCACACGTGTTGCACCGCAGTTGTTGCAAGCTCTGT
GAGAGACATCAGGGACGAGATGGGATCTCAAGCTGACCTCCTGGCAATTGAGCACGTTGCATGGCCTGCGAGGCAGGTTTGGGAGGCGTTACGGGATCGC
TACTACAATGAAGAGAACCCTGATGTTGTTCGTGGACTGTCACAACAACAGGTGGTGCAGCGTGTGTACCGCGCGAGACGTCAACACTACGCTGGCAATG
TTCATGGCTCGATCGAGATCCCCCCGCTATCATTAGCACTTGGTGAAGCAGTGCCCTTTTTTCAGTTTCACTACACAACCATACATCGTGACGATTATAA
CAAGCCGACACGCCTTCTTAGATGTGCGCATCCTTCGCTTGTTGCATTGCTTCGCTACCATGGTACTGCGCTATTTGTCGATGGGACCTTTAGCTGTGTC
CCAAGCGGCTACGCCCAATGCGTGGTGTTCATGGTTCACGACCGCGCTTCAGGCGTGTTTGTTCCAGTGTTTTACATTCTCAGCACCTCACGGACTGCAG
ACTCGTACTGAGACATAGTCCATTTTGTTGTGCAAGCCACAGACCAGCAGATTAGTCCCGCTGAGATAGTCTGTGATTTTGAGGCTGGGCTAATGGACGC
TCTTCAAACGCAGTTCCCGAACGCTATCGTGTTGGGGTGTCTGTTCCATCTGAAACAGGCACTATGACACGCATCGCGATTCCAGAGGAAGAGTATACCA
TTGCTATGACGCGTGGCATTTTAGACGTGCTGACTGTCATTAAGCCAGATCGGATCGAAAGAGGCATTAAGTGGGTTAAGCGTGAGATCAAGCGGCGTTG
TGCTGAAGCTGGGAATGTCTACTCTACTGACAAGTGGGGTGAATCCTGGACTGACTTTAATCGCACTTGGATTGAGCAGTACTCTATCGACCTGTGGAAT
GTGTTCAGTCTGGATAATGAGCTGATTGCGCGGACAAATAACCCGTTGGAGAGATTCAACAGGAAGCTCAGTAGCCGATTCCCGGTGCTGCACCCCTCGA
TGGCGACTTTCGTAACGGTGATTAAGACGATCTCAGCTGAGTACATTCGCCGCGTTGCTGATGCTCCTCGTGGTCAAAATGCCCTTCACCAACCGTATGA
TAGCGAAATTGAAACTCAACAGGTTGTGGTTGTGAGGAGGGAAGGAACAAGGATATGGAAATACGGCGGAGGGATGAGGAGAGAAGGTTCACCGAGGGGA
AACTAATTTGATGTGGGCGTGTCCGGAATCGCAGGTACTCTGTATGGCCATGCTCGCAATGTGGGGGCGAGACAACCAAACAAGGCCTGGCTAAAAAGCA
ATTGCGTGCTGCTGGGTTTCGAACAATTCATCGGAGCCCCTACGTTCGGCTTACTTGACAAGAGATGGTATAATATTTGCGCTACGGCTAAATCACAGTC
GTTGCAGAACACCAGTGTTTTACTTCTTGGTTTTGTCCTTCTCTCGAAGCAAGTTAAATAGTATTTTTAGCCAATCGTCATCTTCCGAATTAAGTTGGTC
ATTTATAATCTTTTTGTGACTGAGATGAAAGATACTAAGCGTAGCTGGTCGGTTCCGTCGAGCCTTCAATTCAACGTCGATCGAAGCAAGATCTCTCTCG
ACTGCACGAAAGTAATGTTTCCTCAGCTTCAAGCTTGAGTTATCAAGCTGCTGAACTGAGGCATTGTAAAGATCAGTAGCCACCGCGGTACAATCCTTCC
ACTAATATAGCTTATTGTTCAGTGCTAGCTGTTCACTGTATAATTGAAACTCATTCTATGAAAGTTCGACGTCATGTCATGACTTGTTAAGGCAATGCAG
ATCTTCGATTTCTTTTCTAAGTACTCGTTTGTTGAAGTGTCACGTTCCTAGCACGGTTCACGGGAGTTCGGACCGCAGGACGGTTCACTTTGAACCGTTC
TCTGATTAGCTGAGTAAACTTCGGTGGTTGTGAGGACACCACAAGAGGACAACAAGGGGGGACACTAGGGAGTATCGTAAGAAAGACATTTAAATCAAAC
TAATCTACTCACTTCGGCCATTTGCCTCCAACCACAAACCAACAGGTTAACAGCCGCAGCTCGGTA