Description :
From Genome Similarity Track
Location :
Scaffold_351:12302- 14373
Transcript NameFunction/comments
Phypl_g7309hypothetical protein PHYSODRAFT_517698

Sequence
2071 bases(100 bases per row)
ACATGCACgaggcgccgctgctcaacgtgctgcgccagcgcttcgagcgcgatGAGATCTACACGTTCACGGCGGATATCTTGCTCTCGATCAACCCGTA
CAAGTCCATCCCGCTGCTGTACGACGTCGTGGGCTTCATGAAGACCCGCCAGGaagctgccaccaccacgggAGACGGATCgaacagcgacagcagcgca
cCGCCTCACTTGTTCTCAATCGCAGAGAAGGCGTACACAGGCATGAAGGGCGTCGTCCCTGGATCTGGAACGCCGCAGTCCATTGTCATCAGCGGTGAGA
GCGGCGCCGGCAAGACGGAAGCCTCGAAGTACATTATGAAATACCTCGCCACAGCGAGCAAGCACGTGGCCACTACGAGCACCGGAAAAGCGGCAGcggt
tgctgcaggcgtccacgagcagatcgaggaGTGCGTGGTGCTCTCGAATTTGATTCTCGAATCCTTTGGTAACGCGAAGACTTCGCGCAACGACAACTCG
AGTCGCTTCGGCAAGTACATTCAGATCCACTACAGCACCGAAGGCCGCATGGCAGGTGTGTCGATCCGCCATttcttgctggagaagacgcgtCTCGTTC
GTCCAGAAGTCAACGAGCGCAACTACCACCTCTTCTatcagctgctggcggggCTTGATACGTTGACGAACGCATCGACAGACTCAGCTCGACCGCTTTT
GCTGCGGAATGACGTATGGAACTATACCTACCTCACCCGTGGAGACTGTGTGGAGGTGGACGGAGTGGACGACGCTACCGAATTTGAGCAACTTCGACGG
tgcctcgagcagcttggaatggacagcgccagcttccagcgcccCATGTTTGAAGTTTTGGCCGCCATTCTGCACCTCGGCAACGTGACCTTCGAGAGTC
CGACATCACAGGAGCAGAGCAACGGAGACGACCACCAAGAGGACGAGCCGACAAGAGTTGTGTTTCCAGAAAGCGGCGCTGGCGTGAACCTGGAGCATGT
GGCCATGCTACTAGGCGTTGATgccgccgagttcgccaaCAAGATGGTGACTCAGACCACGGTCACCGGGCGCGGAAGTATTTTGGAGATCAAACTTACT
CcggagcaggccaagaatGCTATGGATGCGTTCTGCAAGTATCTGTACGGCGAGCTGTTCCACCACGTGATCGCACGTATCAATGCCTGTGCCAAGCAAC
ACACGTCTCTCATACCAACTGCTGGtgccgacaagaagacaGCGAAATCTCGAGTTCAAGGTGGTGGTTCGACCACACTAGCCGTGGCCCCGTTCATCGG
GATCCTCGATATCTTCGGCTTCGAGGTGATGAAGCGCAACAGCCTCGAGCAGTTGTGCATTAACTTCACGAACGAAACGTtacagcagcagttcaacaag
cacgtcttcgtcctggagcaggagcgaTACGCTCGCGAAGGGATCACCGTATCCCCCGTCGAATTCCAGGATAACCAGCGCTGCCTGGACCTGATCCAGA
AGCCGCCTCTCGGGTTGCTGCCTCTCCTTGAGGAGCAAATGCTGCTCAAACGCAAGACGACAGACAAGCAGCTACTCACGATTTACCACGGGAACCACCT
GGATAAGCATCCGAGCTACGCGAAGCCGCGCTTCGAGTGTGACGAGTTCATCATTCGCCACTACGCAGGAGATGTCACGTACGATATCCATGACTTCATT
GCGAAGAACACAGACAATCTGCacgacgacttgctggaTTTGCTACGCCGAAGCTCTCAACCGCTTCTGCAGGCCATGCTCAGCACCCCAGCTGCAGCCA
CAATGGGCGGTGCTGCTACTAAACGTGGAGGACCAACGACTCCGACAGGAGCCATGCACAAGCGTGCACAGAGTGCATCGCTCACCGGAACGACAACAGT
GTCGAGTCGATTCCGCACACAGCTTGCCGAGCTCATGGATGTGTTGTGGAATACGACGCCGAGCTACATCAAGTGCATCAAGCCAAACAACCTCAAGTTC
CCGGGTGGTTTCAGCTGCGAGCTTGTGCGCGACCAGCTCATTTACAGCGGCGTGCTTGAGGTCGTGCGAAT