Description :
From Genome Similarity Track
Location :
Scaffold_148:12300- 13625
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19604hypothetical protein

Sequence
1325 bases(100 bases per row)
TCTCGGCGCGCTTTCCATGCTCAAGCACTTGATCCCGATAGTCTGCGGACGTTTGGTCGAGCTCGAAGCCGTCTTTACGAAACAGCTTCATGAACGGAAG
CAGCAGCTTTGCTTTTGACCGCTGCTGCTTTGCTTCTCCGGCATGCCAGCCTGGCTCCAGGTAAACCAAGCTGCGTGAAGGTGTGTAACAGATCCTCTGC
GCTGTTTCTTCTTGGGCTCGCTCACATCTGCTGTGTCTTCACCTTGCGTGTTCCTCTTGTGCGCTGCAGCTACAAGATCTCCGTTAAGCTTTTCCTCTAG
CATGCCCATGCGGGTATATTGGCGCTTGGAATTCTCGATAAGGTGTTTAATGACAGCGGCTTGGTGCTCGATGATCTTCTGTTCTTGGCTTGGCTCTCTT
GGGTTGGACTCGTGCTTGCGTGGCGATGTGGCGGGTTCTCACTTTCTTTACAGGGATTCCGAGCTTCGGCAAGATGGGCTGACCAGGCAAGGAGATCGGC
AAGCGTACGCCCAGCGTATGCAATACAGGTTTCGAGTCGATTCAGCGCGGGACTTTTAGGATTCAAGTCCTTCAACACAGGATAGTGCCGAACGAGACAG
GCGGTAAGAACGTCCAAAATCTTTCGGTTGATGTTGAAGGCCTCCGTCTCAAGCTGGTAGCAAGCTGCGAACCCGTTGGAACCGAGCGATCGATTCAAGC
GTGTTGGCCTGGAAGCTGGACAGGTCTTGTAGATGGACAGCGGCCGACGGTTTGTATCCGCTCAATGCTTTGGCAATCATATGATATTCTCTACTCGTGT
TGAATATGTAGTTGAATCCCTTGTTTGTGATACTTAGGTTCCAAGATCCGCTGTCAAAGATTGAGCGCACAGTCATCTTCTCGCAGCCGTTGGCATGCCG
CGCCCCAACGCAGAGGAAAGAGTGCGACGTTACGCAGCCGACATACCCACATCAGGGCAGACACGATCAAGCACACGGTTGACATGCGCGTAAATCGTCG
GTGCCGTGTCAGCACGAGGAGGTGGAGGCACAGACGTCGAAAGACCAGGGATCAACAGCGGTGCGTTGAGAGGCTCCACGAGCGGAACATCCGGAGAGAA
CGAGATCGGTGTTTAAAGGACTTGGATGGGCAGGTTGTTAATGAGAGCTGGGGACGGACGGAGAGGGCGAGCGCGACAGCTAGCAAGGGACAGATAAAAA
AAGTCGGCGTTCGGGAAGGGCGATAGGCCTTGCTCTTCCGATGTCTTGACACGAACCAAGCGTATGAAGAAGGCACCCGCATCAATGGAGATGTTCCGCT
TCTTGATCATCGACAGGTCGGAAGC