Description :
From Genome Similarity Track
Location :
scaffold_749:1230- 2770
Transcript NameFunction/comments
g10138.t1hypothetical protein

Sequence
1540 bases(100 bases per row)
AAACACGGCCACAACCGAGGGCCTTTTTCGAGGATGATCAGCTGTCGAATCAAACAATCGATCCGGATGATCTTCTGAAGGAAATCAACATGCGAACGGT
GAGACTTCGACGCTTACGTCATGGGGAGGGCGAGTTGATGGCTCCTACTGCTGCAGCTCTAGCCGCTGATGAAGACGAAGTGTCGTTAGATCCAGTGGAC
GAGCGTTTCCACTTTTCATCTATTGGTGGCGTGTACTCGGGAGCTTTTCGACTGGGAAAGAAACAAGGACAAGGCCAGGAGTACACGAACGTTGGGGTGT
ACGATGGCTACTTCAGTGGCAACACACGCTGCGGGAGTGGCAAACTCGTCTACGGGAAGGGAGCAACGTGTGAAGGCACTTTCGACCGTCCACAGCGTCG
ATACGAATACAGTGACAAGCTACGAGGGCGAGCGTACGGATGTTCGTTACTGAATGGAGACGACTACCGAGATGGAGTGGAAAGTGGCGAAGGAATGCAC
TTAACGTTCCCAGATGGAGCCACCTACGATGGAGAGATGAGAGATGGCGTTGTTTCTGGACTCGGACGATACGTGAGCTCAACTGGTGTGGTAGACGAAG
GGATTTTCGTTAATGGAGTTCTTCATGGACCAGCTTGCAAGCGAACGTTTCCAGATGGGTCCTTCGTTGAAGGACCATTCGTCGAGGGTCAACCGCATGG
CCGTGGACGACAACGTGAGCGACACGGAGATGAATACGAAGGTTTTTTCGATGGTGGAGCAAGACACGGGCGTGGTGTGGCTCGGTTTGAAGGTGGACGA
TCGAAGCACGTGGGTTTCTGGCATGAAGATGCTATGGATGGTCGAGGGGATTTTTACTATCGTCTCGGTGATAATATCACTACTGATGATGAACTTGCTG
GTGATACTGGGGAGGATAAAAAGAAGTGGGAGTTTTGGTACGAAGGCGCGTTCATGCAGAACGAAACTCGCGCTCGACATCGCCACGAAGATCTTCGACC
GCATCAGCAGCGCGAATCATCGGAGCGCCATTTACCCTTCACGACCAACGGTAAAAGCCGTGAGAAGATGCCGTTCCTGGTGACTGAGCTCCCCACGCAA
CTGGACAAGCTCCGACGGCGCAAACAAGCGAACGGAAAGCGACGCACAGAGCGAGAAAGGGTTTATCTGGAGCAGCGCGAGTTGGCAAACCTCACGATGT
ACTACGCGCTGCTGGACGATTTCTATGAGCAATGGACGAAACGGAAGTGCGAGGAGCACGAAGACACGTTGCTGGATAGCGAGGAGCTGCGTCGTGTTCA
GGAAGAACGTGAGGCTTTACGAGCATTCGAAGAGCAACGGGCGAAATTCCGGAAGGAGAAGTACAACTTGTCGCCTCGTAAAAAATCTCTTGCGAAATTC
GAACAGCACCTCGAACGAGTGACGCTGACCGAGCAGGTGAGGCTGAAGAGAGCAGAAGATGCCGATGGGGCCGATATATATAAAGTAAAAAAATTAGGCT
AGACAAACAAAAGTATCTTTGAATCTGCGACGTGTGAGCA