Description :
From Genome Similarity Track
Location :
scaffold_44:1230- 2336
Sequence
1106 bases(100 bases per row)
CTCAGTCGGTCTGTGCCGACGTCTTGTCGACACACGAACACACCGACTTCACTGGCTGCGGCCATAAATATCGCCTCATTTGGTGCATACCCTCTGATAA
TTCTGTTTCAACGCACTGATTTTAGCATACAAGATGTCATTGAAGCATTGATGAATGTCGATATCACCAGCCTGAAGATCACCAGGGATTACACAAATAT
TGATGTCGCACGTCCAGCACTTTACCTTGAGCTCCATCGAGGTATGAGCTTTCTTCGAGTCTCACATAAAAATTTCAATTGTTATCATTTATCACAGGTA
CCTAATATTTGATCCAGCTTAAAGCAGCAAGCCGTCAATGaagtggggctgccgaaaCTCTTCACTTAGTGGAAGCTAAgccaaggtcaccgaccttacg
ttctttacaataaccagtacgagtgtagcggatcgcaatccgctacctccaggtACTAAAGACCTTGAGCAAGGTAAACAAACTCTTCTGCTCGAACTGA
AACggtattttattgttttagttgcgacagagccgccaatatcaaaacccctaggttttcctaatcaatatagtaaaacctaatttatatagtattatgc
attactactggcagtcctgtcATGTGGTgatttcttgttacggtgtagccacaccattgtgtgatttcacaaacttgtgtaattcacacctaAGTACGGT
CGcaaagatggtgcgacccgccctttcatacaagggtacatgTAAATTCGTTTCGGTTAGTCCATTCCTTTTTCTAGAACGCAGCGTAACATCTATCATT
TTTTCAATGCTGGCTAGCAAGCTCCTCGTAGATCAATATTTCTTGCCGGCTGCATTCGTCGCAAAAATGAGAGTGATGGGCATGTTTGCTAATCCTGCTC
AGCGAAAATATCGTGACGAGCACCAATAACGTCCAATGTCTGTTTGCGTACTTCTTTAAAGTACACGGCATCATATTTATTAAACCTGGTCAAGATCCAT
ACGTGGTCGCCGATCTTGCAGCTATCGCATGCAGTTGACCGTACGCTCAACGACAACAGCGTCTGCTAGGATAGTAAAGTGCTCTGGCTCGCCTCATCCC
GGACGC