Description :
From Genome Similarity Track
Location :
Scaffold_397:123- 4834
Transcript NameFunction/comments
Phyag_g5347hypothetical protein

Sequence
4711 bases(100 bases per row)
ATTAAGCCGGTGGAAAAGAAGACATGGAGTCCTGTCTTCACTTGGTTCATGGTGAACGTTTTCATCTACCTCAGTGAAGGTGCAACAGGTGGACGTGTTA
AGGTAACCTACGAAACAACGGTTATCGGCGATGACAAGCATGAATTCGAGACTTAAGGAATGCTGGAACGACGTTGACGGGATACTTACGCGAGAGTACG
TATATGTGCAGGCGATATGCTCGCTAATAGCCCATTTCTTTGATGAGGGTTTTGTAACTTGCTTCTTCGTGTACAGTTGTCTTCGTTTCTGTTGCTGTCT
TTACTTCTAGAGCAACCCTGACCAAGTCGCAACAATAAGGCTCTCCAGTTAATTGCTAAAATGACAGTACACGGCAGGGTTTGAACGCACACTTTCTTCG
AGGGCAGCTCCATGTCTAGAAGTTCGAGCAACTCATTTCGAGCGGTGCGCACCTGCAAAATCTGTCATGCGTAGTAATAATGTTAGTGGGCCATAGCCGC
AGATTTGACGCCGGGATGACTTACCGAAGCGTCCCATGCTGTGTCACTCAAAATCTCGACCACCGTATCGTACTTCCACAACAATGAGTTAGCTTTAGAC
GATCATCATCACTGCCAAAACAACATatcagcaccaccaacctTTTCCTCCTTGACAATCTCGTCGTGAAGAAGCAATCGCGTGTAGAGTTTCTGTGCTG
TCAATTTTCGCAACTTGGGGAATTTATGTCCCAGAAACAAGACCAGTGCACGTAATGTCTTAGCTTCTGTCTCGGGGTCGCTAGGGAGTAAACCAACCAG
CACATTAATCGCAGCCCCGAGCTTCGGAACCGCTGTGCACTGTTGGATTTCGTCACGCAGCGCTAGATACAAGCGTTCTCCAAAGTCTGTAGTGGTTGTG
CCACTaccgtcttctgcttctcgctTCTCGGACAAAAAGCACAGCAGATTAGATTCCAGTAGCGATGCCATTGTCTTCATGAGGGGAATCGTAACGCGGT
CGTCTTGGTGATGACGCGTCAGCAGTGTTACCAAGAAAAAACTGAACCGACTGAGCAAACCGAAATCTTTCGCCTGTAAATGTGCTCGGAACCACTCAAA
CAGTGCACCTTTAGAGGCCTTCACCACGCTTTCAGTCAAACCACCAACACTGACGACGAGCCCAGCAGCTACGTCCTCCATAAATTCCGGGATATCCATC
ATTTTCACAACCAATGGGAAAGTATCATGAGCCATGGACCAGTTTACCACGAGCGTCGATGGGAATATCTGCTTCTCAAGCTGGAAACGGTCTGGGATGC
CATTAACACGTGGAGTGGCTGAATGTAGCAACCGGAACAAAATGCTTCCAGCCGTCACGCGCATGTTATCCAGCTTCTCTGCTAATTGTTTTGCTAGCGC
CCCAAACTGTTCATTAAAGCATCGCAAACAAACAAGTTAGTTATGAAGAACGAAAAAGCAGGATAGACAATCACGTAGCTTACAATTGTGGCCACAAGCT
CTGGAGATAAACGCCGAGCAAATGGTATCGCGGATGCTGGACTCGACATAGCTTGTTCTGCAAGTTTAGTACGGCTTCCAAAGTCAGGTATTTCGAAGAT
CTCAGTATTGCCGCCAGTTGGAAGTTTCGCGTTCATAGACAGATTCCGCGCATGTATAATCCCCACTCCACCTGGGGAGAAGTAGTAGTAGCCCAACGCA
GGTTTATCGAACTTGACGTAGCATAGTGGATCTGACGCCGGCACGCTACTATTTTCTCCAACCTTGCATTTTCGGACTGACAAGACGTCAACAATTAGGC
CTTGGCCATACACAGTCTGCGCGATTGTTCCACGAAGGTGGAAATGTTGGTTTTGTGCGTGTGTGCtttcaacgagaagcaaTTTCTCCAGGCCTAACAT
AGCTTCTTTGCGAACCCAGGAGCCGACATCTCCACGCTCATCCAGTCGATAATCTTGATGAATACATCGGACGAGCGTCTGAGCTACAGCATTTTCCATG
CCGTTAAGATCAAGCTCTGCGGGTGGTCGAGAGCTTAAATCTATCAGTGCTCGAACCGCAGCCACTCGGCTCCCTGGATCCTCGTCTTCAGTTGGGCTCT
CCTGAAGCGATAGAGATTGAATGACAACAGCCAAGACCTCCTTCACGCATggctgcaccagctccttcgcAGCAACCCCTACAGCACGCAAAAATCCTCG
TCGGGCAGCTACGTTTGGATTCGGCACATCAATGGATACACCATTTTCCTTAGCAGCTATCATGATTCCGGACCTAATGTAGCGCGGTATCAGTCCCTCC
ATGTATTTCACATGAACTGGACTGCCCTTTACAAATATCTTGGGGCAGTACTGAGCCGTAAAAGCGCCGAAGGCATCAATAGCTGCATCACGTACAGTTT
CTGTGGGGTACACGAAGCATTCTTCCAGCATCGATAAATACTTCTTCACATGAGCAAATCCCAGGCTCAGTTGAGAATTCGATATCACTTCAATCACGTT
GCAAACCGCCGCCCGAATCATCTCGCCGCCACGCCCACGGAATAAACGCCGCTTATCAACCTCAATGGGCAGCATCTTGACCTTCTTTTGCAGCTCTCCA
TCGATAAACACTGGCACCTGCGCTAAGAACGTGAGCAATTCGGCAATACTAATCACAGCGCCATGTCGAACTACCACTTCGACATCAGGTGATAGAGCAG
ATGATACTAGGCGAGGAAACAGTCGCGTCATCGCATGCGGCGGGTCCAAAGCACCGATCTTTCCAAGTGCGGCAGCGGCGAGGCTGCGAATTTGGGCATC
CCAGTGAACAATCTTCGAGTCAATTAGATGCTCCACCAACGCGTAACGGTACTCCGGATATTTCGCCACAAATACGCTGACATCCAAGTAAGCATGGCGT
AAATTCGCCACTGAAAAATAATCGGCTTTCGTAAGCAGATCGATACCATTCGGGAAGTTCGTCCTCCCTTGCCGCCCGACGTTTTCTTGGAACGCCGCTG
ATGCAGCTCTACGACAGTTCAGCTCGCGATCAAACACACAGTTCACAAGCATCGCTGGTGCGAGGATCTGTTTTAACCaaggcaacagcagcgaaggTTC
ATATGCTCGAGCAAATGACCAGCACGCATAGCAAGCAGCATCACGTACGTGAGAGCCAATACTGTATGTACCCTTGCGAATGTCGTACTTGAGGGCATTC
GCCACACAGTCCACTGCATCAGGGAGACGCTGCGGAAGCAAAACCCCTCGACGAGCAAGTTCCGCCAGCGCGAGACTTGCACCATGCCAAGCCCCATCAT
CCTCAGTGGCCACAAAAAGCTCGAGTACAGACTGCACTATATCGTCCGCGAATTCATAAGGAAGGCGTCCAGTGATCCGCCCGATTCCCTTCGCTGCCGA
CCATCGCACCACTGTGTCTTTGTCTCGCAATCCACACAAAAGGACCTCGacgatctgctccagctcttccaccacttcaaaCGTActgtcatcatcatca
tcgttAGCTTCTTGTGGGCGAATTGGTGTCGATGCGGCGTTGTTGCCAGTACTTAGCCCTAAAGAGTGCATATTAAGCTCAAGCGACCGCAAACCGCGAC
TGTACCGCCATGACCGCACTTTAGGTGGTAAATAAAGCAGCCCCAGACGCTGCACGAGTTTCACAATGAGCTTACGATGtaaggtgctgctgctcggacG
GTCTGATTGCGCATTCTCCTCAATAAGATGAGCCACGAGCTTCATCACAGTGGCGAAATAAATGCGGCTGGCTTCAATGTGCTGCTCGCGCGGCGAGTTC
TTGGCAATATGAGCTAGGCACAGCATAATTCCTGTCACTTCAAATTGCAGCACGCGCATATCCTTTCCCTCCGACGCAATTATCAGCTCTCGATTTGCCC
AGATGAGAAACTGAGTCAGATAATGCTGCTCCATATCCGGTCTGCTCAGCAGTCGTGACAAACACACTGCAGCCGCAACTTGGGAAGCTCCAGGATCGCT
TAGGTAGCCCTTACAGAGCGTTACAATATTGGACACGATGGAGATTGTCCCGTTGGTGGTGTCGCTATCACCACCAGGAGACGACGAGTCGATTGTGTGG
AGATCGAAAGGTACGAAACATAGCATCgacagccacagcaacaaaacgTAGCGCGTCTCCCACGTCGAGTGGTCGGTGCGGTCCTgggactgcagcagct
gcagcgtcggctcAAAGTCGCTCACCTCGTGtggcaacagcttcaccaccgtcttgtAGCCGCGCACCTTGCACAGATGATAGACAATCTGGAACAATTT
GTGCAGCCTCGGGTTGCGGTAGACTTGACAAGGGAAGGCCAAGCCGCCATCAGgtgcagttgttgttgcttcgACCCTCTCGGCCACCACTCTCTTGATT
TCGTTCACTGTGGGGCTCAGTATCTCACGCAGATAAGGGTCCAGCAAATGGGACTGCTCCAAGTACCTGTCCAACTGCTATTGAGATTAGTTTTTAGTGA
AAAGTGACGGAATGGAATCATCCCAACGTACGATCTGCGTGACGGTGGAGTGGGCTGCTAGAAACTCACGATCCACGTCGCTCTCAGGCGTCGGGAGCCG
CGTCTCCACCagtttctgcagcagatcgcgcacttgctggcgctcgctgaagaagcgcttttcgctgcagctctcgcccTCCTCCGTGGCATCGGGCATG
GCGCCTGCAGA