Description :
From Genome Similarity Track
Location :
Scaffold_1383:123- 4397
Sequence
4274 bases(100 bases per row)
GGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGTCGGATTGAGATCCAAGCGATAGAGGTTGGATCCAAGACCGTGGATGAT
CCCCAGAGCAGGCCCCTAGATAACTCAGGGTCGGTGGATGAAGGATCGCAGAGGGCTGAAGCCGGACCGCCAGATCCCGCTGACCCCAGAGTGGATCCTA
GCTTTTCATGGGGCCAAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAGTCAAACCAGAGCCGTCGGGTTTAAGCTCGCTAAAGGATCAACTCGATCC
AACTGGTGGCTTCCCCGATACCAGGGTACCTGATCCCACGAAGACAGAAGGACTGACAGGTGAAAGAGGGTCGCGGTGCTTGGATCCAATGGTGGATCCG
ACGAAGACGGAAGATGAACAAGTCTGTTACCATGAAGGCGGGGATCTACTCGCCGAGGATCTCGGGGAAGGCCTGGCGGTAATCCCGGAGGTACCACTGA
CCACAGAGGAGGTCACGATTGACGATATCCAAGTGGATCCAGGGGCAAACGAGCCCGCGGAAGTGGATCGGTTACGTCATAAAATCTGGGAGAGCCGACA
TCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAATCGATCGCTCAGAGGGTGACG
AAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGCCTGCTGCAAGCCAAGATCATCAGTTTCCCAACGTCCCCGTGGGCATCCCCAGT
GGAAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTA
ATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCG
CGATATCCGCATTCATCACACCGTTTGGACTGTTCTAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAA
CGCTCTCTATGGATTCACCCGAATACCGGAGTCCGAAAAGGGTGGGTCTGGGGAAGGCCATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGAT
CCTGGACCCCGTCTGTGTTAGGACGCAGATCTTATATCGACGACATTCTAATCCCGGCGGAATCGTGGGAATAGCTGTGCGAAAGAGTGGTATCCCTACT
GGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAGTACTTAGGCCATCGAGTTTCCAAGGAGGGA
TTGGAGGCGAATCCTAAGGACCTATCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGGGTGATGCAATCCTTCTTGGGCAGTTTGAACTACTACA
GTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGATCGGTAGATTTCGCTGCGATGACCACTCCAGCTGTCCAGATGAAAAT
CCAACAAGCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGAC
CAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAATATGGAACAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGA
GGAACAGAATCGCGACCACGCCTATCCTCCGTCACTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGTTCT
GGTTCAAGAACATGAGGGGATCTGCTATCCAGTCACATTCGTCAGCCGGACACTGAAGCCGAATGAACTAAACTACGGAGCGGTGGAGAAAGAGATACTC
GCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGACCCATCCGGAACCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGG
CCGGGTTACAAGGACGTTTTAGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAGTGTTCGAAAGGGGAAGACGAAATCCTGGGAG
TCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATAGATGAGGCGCTGACTAGGATCGCCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCC
GACGGTACAGGCAGACGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGACTG
CCCGGATGGGAAGTTGTACGAGACAGATCCACTTACGCAGAAGGCCTCACCGTCAATGAGGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTAACTAA
AGGGACAAGATCCAAAAAGGCTGGTGATTTGTGGGGATTCCAATTTGGTAATCAGACAGGTGCGAGGCGAGATTGACTGCAAGGCCCCGGCCCTAACACT
GTTACGGCAGAAAGTGATGATCCACCTGCGTGGATGGTTGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGACAGCTTGGCCAGT
GCCGCTTTACTGAATCAATGTGGTGTCGAAGTGGAGAGAGAAGCCGGGCATCAGGATCTCGTTACATTGAACCGACGAGACGAAGTGGTGGTAGTTGGAT
CCAGGAAAAGAACGGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAGATCCTCGAGGAAACATTTGTGAAGGGAGTCCG
TATTGAGCGGATCCTCAAAGCACAAAACGAGGAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACT
AAATCCTACAGTATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGAT
TGATGAGACTGGTGATGCCAGAAACCTTGCAACAGGATGTCCTACACCACTACCATGCTAGCCTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCA
ACGGATCCGGGAATGTTTCCACTGGAGAGGACTATTCAAGAGCGTACAACGATATGTCGGTGAATGCGTGGATTGTGAGACAGGCAAGGGCAGGCCCACA
ATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAGCTCGCTCAAAGGAAACA
CAGAATTGTTGATTTGGGTGGATTTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAGCCATTGCTGAATCGTACGAGGAGTG
CGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTTGAGCATTCAACCGGATCCTGGGGCAG
CGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGATCGGCCGAGCGCATGGTGCAGACAATCACGAGAGCACTCAAGATGTATGTCCAGGATT
TGGATCAGAAGGATTGGGATGAGTACGCAGAGCGGCTTCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATGTTACTTGGTACA
TGGGTGGGATCCCAAATCCACCCTGGAAGCGGCCATCCCAGTTTGCAGCACCAAGAAGAGGAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAA
TACCACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGGTCGAGCGGATCGACACAACGAAGATGCCCGTCCACATCAAATCC
AAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAGGGGTATGCCCCGCAAATTGGCCCATCTATAGCATGGACCGCTCCGGGTGAGCGAGA
AGATTGGAGAACACGCGGTAAAGCTGAAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCC
GGATCGTCCGCAGATCCGTCTTTCGGTGGATGAATCCGACAGGGTGGATTTCGACGAAGTCCTCCTACCGGAAG