Description :
From Genome Similarity Track
Location :
Scaffold_1353:123- 3185
Transcript NameFunction/comments
Hyaar_Emoy2814681hypothetical protein

Sequence
3062 bases(100 bases per row)
TATAATGCTGCGGTAGAGTGTCACGTTCTCGCTCGTTCTCGCTCTTTTGTGCGCTTGCTATGCCCGAGTTTCGACATACTCTTCTGTAGCTTTCGCCGTA
ATGAACCCTGTTCCTGCGGTGTGCGTTGAGGACTGTCAGTACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCAAGTGAGGCCGTCCAACTTTACG
GAGAGTAGCAATAATTTTCCAACAATTTGTCGCTTTAATAACAACGTTTCTGCATTACACAAGTTTAGTCGTGTGAACAAGGGCCACGCAAGCGAATCGA
CGAGTCAACTTCCCGCTCTTCGAAATTCTCGTAGACCAAATGTACAGGCACATCCAAGTAATTGGCGAGGCCCATTTGTAAGCTGTCGGAATGCAAGCGC
AAGAGGAGTTTGCAAGTCAGTAACTCCACTTCCACTCGTCTAGACTTCTGCTATCGCTGGTACCTCACTTGCACTGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCGTCGGGAAAACATAGGGGTCGTTCGGGACACGAGTGATACCCCGTAGTCTGACTCAGAATGTAGCAAGAAAGCCACACGTGTCATTT
AAAAGCACTGATTTTTAGTCATGGCACATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTACATGTGACGACAGACTGCGTCACTC
AGGAATTCCAATTCGCTACGAGTTTCTTCGCAAAGATGTACCCGGTCGATGAACGATGTCTACTATCGAGAATANNNNNNNNNNNNNNNNNNNCATTATC
AAGAAGTTATGACACCTGCAATCGATAGAAAAAAGATCTACCTCTACGAGCGTTTCCTCAGCCGTATATTTGTGAATGTAAGGATGCTGAAGAAGTGCAT
CCGCCGGAGGCCGATCGATTGGGTCATGTGTCATGCACTACACACACAGGCAGTCAGCAATATGTGACTTACAATACGGTAGAGTCAGGAAGATATTTAC
AGAACCTGATCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCAACGAACGTATCAACTGCACTCATGAAGTCAACCAAATAAAGAATCCATCCTGCGTGGGCAGCGGATACCTACCTAAGGGAACAAATATCATGG
CAAGTCCAAAGGACCGCACATCAGCTACAACCAAGACTCAAAGGTCAGCAATAATGGCCGTTAGCAAGAATCGCGCACGCAAATTTGCTCACCTGGGTAG
ATTCCGCCACGTATCCGTTCAGGGGCCATGTAAAGTAAGGTACCCACGAACGTTTTTGTAAATGTAAAATTATCGTTCAGGGTGCGCGCTAGGCCGAAAT
CCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGATATTGCGATGTACTATTTGCTTCTTGTGAATA
TGAGACAAGCCGCGCAGTTACACCGGTCGCTAGCCGTGCGAAACCCTTTCATTTCGGCAGCCGCCACGTAAAATAATATCTCGTAGCGATCCCGTTCTCA
TATATTCCATGACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATGCGTCATATAAGAATACTATGTACGGACTGGGTCTACTCATTAC
AAGCAAACGCACAAGTTATTTAGTCGATACGTACCGTGCACACATATATGTGCAGTTGCGTACCTTGCTTTAAGTTTGCCCGTGCTTNNNNNNNNNNTGC
CGGTCGAGAAACGTTGCGGTATCGGGCTGTCACTATCTGTCATGGGTACAATATTGGAATAAAGCATTGAAGCTCACGCACCATTTGCCGCCGCTGGCCA
CGCCCGTAATCGGTTACTTTTCCTTTATTATGCAAGACACAGCTGCACGAGTNNNNNNNNNNNNNNNNNNNNNNGTGAAAAAGCATCGATGAGGCAATGA
ACGAGTATCCTGAAACCTTGACTGCGACAAATTTAAGTGTTGGGATGTGAATTGCCTTATATACAACAGCGGAAGCGCCCCGACCAACCTCTTTTACACG
CTAANNNNNNNNNNNNNNNNNNNNNNNNNATCGGGTAAAGAAATACCTGCCTCTGATACTGCCATATTTTTGCTTGTAAACATGCCGTGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGCTATGTAGCTCGCCGTCTGGTCGCTTCAAGACCACATACGTACTAGTTAGTACCAAATCGCCGAAGCTATTTGAATA
GTTCTGAACGCACCGTCTGGAGACTGAAGGCCCGACTCTGATCCTGAACCAAGATTCAATTTCATCGCCGCGTGCTGTGCGACACTGGGTTCATCGCCAA
AGTCACCTTGACCCGATGAAATATCAGCTTCAATACCTGCAGCCTCTATTGCATCTCGCTTCGCAACAAGTCAAGTTGCAGCTTGCTGGGCCCGTTCTTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTTTAATCGTGGCTGAGGACGTTTACGAACGCGACTGTTGGGGCTTCTATTTGCTGACCCGACAGCTT
TCCAAAGTGGTGCAGGNNNNNNNNNNNNNNNNNNNNNNNAGGCGACAAGCCTGCGGATGACAAACATTCCCCTGTTGCCGGCGGTACGAGCTGTCATGGT
TCTTTTTCTTCTAGTAATGATGAATCAGTCATTACGCCAACCTCGTTGTTCAGTTGTTTTGCCGCACTGTTCTCTTGGTTTACCAAGACGTCTACATCGG
TCCGGCAACGTCCATTTTTTTCACTTGTTGTCGATGCTGACTCTGGAAGAGAGACTCTGCATGAGTAGACGTGGACGCCACAAGACTGCTTGATTTTCTC
GTATTTGCGGCTGCTCCAACATCTCTGGGGCTGTCTATATCTTCTNNNNNNNNNNCAGTCTTTACTCATCCACGGAAACTTCCACAACTTCACTTCTGGA
ATACGTAGCTCTCGTGTACATATATCTGGAAAGATGCAAGTGATCATTTTTTCGTCTGCCTA