Description :
From Genome Similarity Track
Location :
Scaffold_2116:123- 3152
Sequence
3029 bases(100 bases per row)
GCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTAC
GTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAG
GGATGTTGCCGGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTT
GTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAGGGTCTCTAGTTTGC
GCCAAGTGGACGAGTTTTCCAGATCCAAAGTCTCTTCAACCCTGGATCTACAAAAGGGAGAGGCACGTGGTTACTGGGAGAAACGCCAACATGGTCGATG
GTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTGTGGATCTGAGGATGTTGGATCCATGGATCTGCTA
ACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTAC
TTCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGAT
TGGTGAAGGCGTATACCGTACAAACGGGAGAACGCGAATTAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCT
GGTCAAGACGCCATCCTTGGGATGGATTTCATGGTGCCAGCTGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCC
AGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGTCAGA
CCGGTTGAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTACCTACAAATGGGTACCTACCGTAGTCCAAGGACCAGGTCGAT
CGCAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAAGAGATCGGACGATGGTTGGCGAAGGACCGTATTCCTAGGCG
ACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAGAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGTGGAGCTC
CCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGAGATCGACGGGTTGAGATCCAAGCAATGGAGG
TTGGATCCACGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGACGAAGGATTGCAGAGGGCTAAAGCCGAACAGCCGGATCC
CGCCGATCCACAAGTGGATCCAAGCTTTCCACTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACGCTAGACAAACCTGAACCGTCGGGTTTAGAC
TCGTTAGAGGACCGGCTGGATCCGACAGGTGACTTCTCCAGTACCAGGATACCCGACCCCACGAAGACAGAAGGGATGACGGTCGAAGGAGAGTCGCGGT
GCCTGGATCCAAGGGTGGATCAGACAAAGACCGAAGATGAACAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGTATGGC
GGTAATCCCGGAGGTACCACTGACCACCGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAACGAACCCACTGAAGTGGATCGTCTGCGT
CAGAAGATCTGGGAAAGCCGACATCTGCTGATCGGTAAGGGTAATGCGTTACCGCCCGCCGCCCACGGAGTCAAATGTGACATCGATGTCGGCGACGCGA
AACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAAAAAAACTGTCGGATCTGATTAAGGGCTTGCTGCAAGCCAGGATCATCAGCTTCTC
AACGTCCCCGTGGGCGTCGCCGGTGGTAATCATCATCAAGAAGACGGGGTGTATATACGTCTGTGCATTGATTACGCGCGTGTTTACACACCCGCCCTCA
CTGATGTGGTGGTATATCCAATGCCTCTGATCAATGAGCTGTTGGAAGATTTGGATAAAGCACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTG
GGTGGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAACGCA
CCCCAGATCTACCAACGCCTCATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAGCCCGAAACGGGTGGATCCGGGGAAGGTGACGCAGAAGTGG
ATCCATTCGAAGCGGGGGAACCAGAATCCTGGGACCGCGTTCTGTGTTGAGGAAGACGAATCTTAACTTGCGAGGACATTTATGATCCCGGGCGAATTCT
TGAGAATACAGTTGTGGCGAAGAGAGTGACCTTCCTAACGGGAGGCGTGTAACTGAGTGAGAAATCTTCTCTTTCCAGCGTGGTTAAGAGACCTTTGGGG
GAGATGCGCCAGGGTGAATTACTTGGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCA
CAGTCGTTACGAGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAAGATTACGCCTTGTTTGCCGCGGTGTTGTATGAATTAA
GAGAGGTAGATTTTGCTGCGATGACCGCT