Description :
From Genome Similarity Track
Location :
Scaffold_322:123- 2692
Transcript NameFunction/comments
Phypl_g6945conserved hypothetical protein

Sequence
2569 bases(100 bases per row)
TTCAGGATTGTCTGCACATATCGCTGCTGTGTGGGGCTTCAGTTCGGGTGGTTGGACTCGCAGAACTCGTGGATGTATCATCTAAGGAGCCGGATCGGAT
TGATGTCGCAGAGTCCGTCAGTGTCGAGGATTTCAGTGAGCGCCGCGCAGGCTGATGCTCACCTGCAGCAGGGGCAGGAGCTTGCATCAGTGGCAGCGAA
ATCATTGACATGGACTTAAAGAAATCCCGGCTAGCAACGGCAGAAGCTCTGgtcgcctcctcctcagccTGAAACACCGCCAACTTCTCCTGGATGTCAG
CCATCTCTTTGTCCAGAACAGTGCTCTCCGCGAGTACGACTTTCTTTTCCTTTTCGTGCGCGAGCTTAAGCGAGCGCAggtccttcttcgcctgAGATTT
CAGCTGACGCTCGAACTTGGCCTGCTCGGTCCGCACACTATTCACCTTCTTGGCATGCTCGTTTTGTAGGGCGAACACCTTCTGCACGTGCtttgtcttc
ttctgcacgagctcgcgctccaaCTGAACAATCTGAGCCATTAACTCCTTCTGCTGAACAAGTAACGATCGCTCTTCTTTGTGAAAGCTGCGCTGTTTTT
CCAGAACTTGCGCGGTGGCAGCCGAAATCTCTTCCTTACGTTGGCGGTCTGCAGCGATagtcttctccagctcttctGTCCGACTGCGAGCCCAGGCGAG
GTCGCTCTCGGCGTTCTTCACACGCACCTCGTGCTTCAGGTTCATGGTCGTGATCTCGGTCGTGAGACGTTCCAGCTCATTCTTTTTGCTGTTAAGCTCA
CTGTGAAGTGTTCGACGCAGATCAGAGAGCTGCTCCGTAGCCTGGGCTAATTGCTCCTCAAATGAACGCTTCTGGTCGTTCGCAGAAGCGGTTGTTTCTG
CGTCTTGTACCTTGGTGAGCTCGTACTCGCTACCAAGGTTCTCGTTTTCCTCCTGCCAGCTCCGCATGTGTGCTTTGTACTGTTGAAGCACCATCGCGCT
CCACTTCTGAATGGATCTGCGTACACACTGCAGCAAAGCCTCCTTTATACAAGAATCCACAGCTGGCCCGCTGCTTTGTTGCGCGTATTCGTCGAGCGCG
CTCCTCAAATCCGACTTGTACTGCGTCAGCAGCCGGATCAAACCATCGGAAAAGTCTTCTCGTGGTCGTTGGGCGAGCTCTGTGGCCACAGCCTCAAGAT
TCTGCGGGAGGACACGCTCGAGGATCTTGGTGCAGACTTCCGTTGATAGTGTGGAATTGCGTTCTAGGGTCTGCTTGAAGTCACGCTTGACCTGAGCTTC
CCACCTAGCTACATTGTCCTTGACCACAGTCTTTTGCAGCCTCTCCGGAATGCTCGAGCGCACCTCACGAATGTGCGCCATGGCTGACTGAACACCACGG
AAATGAGCGAGATGCAGATCTCGCTCGCTCAGGGCCttttcatcgtcgtcttctttcGCGGCTTGCATCTCTTTGGTATAAGTCTGTTTCGCGACTTCAA
AAGCCTCAGcgacctcctgctccagcagtgCGTTTGACGCCTTCTGCATCGTCGGAAGCTGCCCGACGTTCAGTGCTTCCACATACGCGTCAAGCACCGC
CACAAACTGTTCCGagcgcagctcgtggcccATCAACTGCTTCGacgggagctgctcgctcttGTCCGACAAGTAGCTCGCGTACAACTCATCAACCGCC
TCGACGAACTGTGTGCGCAGTTCGCTGCGCGGCGTCTCCGGCGGAACCACCTCAAGGGTCCCATTGCCTTCCACCGCACGACTCAGCGCCACACAATCTC
TGACGGGAAAGTACGACTCGAGGTACATGCGCAGCATGTTCCTCTTGGTAGCCGCGTCCCCGTAGCCCCCTTCAGGAGCCAGACACTGCTCGAAATACTG
CGTGGGGGTCAGCTTCTGGCCCTCGACGTCCTTGAGCCACTTGACTTTGAAGTTCCTGGCCAGCCAGAGGAGCTTGGGTGAATGTTGGTGGAACTCACTA
GCTGCAGTCACGATAGCATTGGGCAGAACAAAGCTGTTAGCGTCTCCATACAAGACAAGAGAACCCCCGTGCCAACTGCAGATGTCCTCACCGACAGCCT
CTTCGTCCTGCGTGGCCTTGACTCGCAGCACCTGagccaccttctccacccACTGCAGCCTCTGCACGTCGATCTCTCCGTCTGCgttgtacagcagcac
ggacgagagcagcagcagcagcgccagcttctggtccTCCGCCTGTCGTCCGCTCTCGGCCTCCAAAGCCGCTCCAGCGGCCAGAACGACACGCGCCTTG
TCGCCGGCCTCCAGAGCGTCGTCCTGAGGCAGCCACAGCcacagcaacacgctgctaTCGCCCGCAGGAGCGCCAGAAAAGCCCGCGTCttgaggctgca
gcagagtgtgcagcagcagccgttTGCCGCTCGCTGGAGGGCCGAACACGCCCAGAACGCCCACGCGCTGGGCATGCATCGAAAGCAGAGTGTCTCGCCC
GTCTGACGAGACCCGCAGcgccgctccagcgccgccagaGGCCGAGAAAACCAGCGGCAACGCGCGCCA