Description :
From Genome Similarity Track
Location :
Scaffold_2322:123- 1318
Sequence
1195 bases(100 bases per row)
CTCCGTGATCAGCACCTCGCGTAGGCGTTTCAGCGTGCGTAGATCATCGTGGTCGTCGGTCGGTGCATTTCTACCCTCTTCGCGCTGCAGGGTCTGTCCA
GTGATGTGGTCCGCGGCCGCGTTGTAGTCTCTCTTCACATGGATCAGATCCACTGTGTCGAACTTCTGGATGTCACGGAGCGCATCGATCCAGAGCAGCT
TCAGCCCAGGCGTACGACACTCGATCTCACCACGCAGCTGCTGGATCACTATCCTCGAGTCTCCACACGCGATCAGCTTGCGGATTCCATGCTCTTCAGC
GATCTCCAACCCCAGTAAGATACCCTCGTACTCTGCTTCATTCACCGTGACGTCAGTTATATATCTGGATCGCGCCACGACCACCTTCCACTCGGGCAAT
TTCCACAGGATCGCGGCGTACGATCCGCATCTTCGCTTTGCCTTCGCGGATCCGTCGAAAGAAATCACGTATGCTTCGTCACTAGGCCCAAGCCGGGGTA
GGATCCTCGCATTTGGTGGTCTCATGGCGATTTTCCGTGGTCGGATCCCTTCCAGGATCGCGTCCACCTTTGCGCGTGGCGTCACCGACGCAGCGATCAC
TCCGCATAGCTCGTCCTCGCCCTTGCGTGCTCTTTCGACAGTCAGATCCCACGGTGACAGTATGGCAGCCCATTGTGCTAGGCGCCCCTGCAAACCCTTG
GATCCAAACAGCCATGCGAGAGTCAAATGCCTCGCGATCACGCGTATTGGCCTCCCGATCACCATGTTGTGGCAGAGATCCAACACCTTGAGCAACGCTA
GCACCTCCTTTTCCACTGGATCGTAGCGGATTTCATGGTTTTTCAACACCCGACTTGCAAACCTAACTGGCATCAGCATGCCATCATGATCCTGTAGCAG
GGATCCAGCAACCACCCAGTCGCGGGTATAGAGCACAATCACGATCGGTAGTGCTGGATCGAAGTGTTGTAGCAACGGAGCTTGGATCAGCCTGTTCCTG
AGCTTATCGAACGCGGTTCGCTGCTTGACCAACCCGTTGGATCCGAGCCGGAAATCGTCCTCAGTGAGTTCATACAGGATGCCAGCGTGCACAGCGAAGT
CCTTGATGGACTTGTTGTAGTAGTTGAGGGATCCCAAGAAAGACTTCATTGCCTTCAAGGATCCGGGGAATGGTAGGTCCTTCAGCGTCTCCAGG