Description :
From Genome Similarity Track
Location :
Scaffold_129:12298- 14135
Transcript NameFunction/comments
Phypl_g3779hypothetical protein

Sequence
1837 bases(100 bases per row)
CTACTCGAGTCCAtttcttgttcttcttgatcagCACCAGGTCTTGGTGTCGTGAACTTCTCGTCTCCTGCCGGTCCAAAGCCGTCAGCGACAGTGTCCA
ACCGTCGCGCCCTGTTGACAGgtttgagctgcttcaagaTACTTTTCCCACCTTGAAGTGGCCTGTTCGTCGACAGTACAGCAGTGTAAGTTACggacca
agcagcagctcgcgtccCGTTTTCGTGACTGGTGATGGAGGCTTCAAGCATtaacgcagcagcgcaacgcACGCTCCGCTTCGTGTGCGGGTGTCGTGCC
GATGGAATCGTACCAGAAGCGTATTGTCGGGACGTGGAGACGGCTGCAGAGCCGCCGTcgaagcggcagcgcgtGGGTGAGTCTTCGATTGTCGAGGTGC
GTCTTGTCGAGCTAATTCGCGacctggacgaggccaacgaTGACAACGACAAGCATTACGGCCTGTTTGTATGGCCGTCGGCGCTGTTATTGTCTCGCTT
CGTTGCCCGGGAAGCAAATTGGCTCTGCCGCGATAAAGTCGTGCTGGAAGTGGGCTGTGGCACAGGACTCCCGTCGATTCTCGCTGGCTTGTGCGGGGCT
GCGAAGGTCTATCTCACGGATCgagccgacgctgccgacaTCCAGCGCAACGCAGAAGCGAACATCAAACGGAATGGACTTGAAACTCGTGCTGCGTTTA
TCCCCTTGGCCTGGGGCGACATGCTCAtctcggacgagctcatttcCATCTTCCAAAGTGTCCAAGTCATCCTCGCTGCCGACTGCTTCTACCAATCTCA
AGGTGCGACGAACCACTTCAAATTGCTGCTCAAATTCTGTCAACTTAGCGTGCATTCTTACAGATTTCGAGAAGGTGATCCCTACTGTGGCGCTCATCTT
CCGCTGCAGTGGTGGTCCAGCCTCGTGcaagttcttcttcacctACCAACTGCGCAGTATCAGCCGGTCAATCGCCCCCCTCCTCTCTCGCTGGGGTCTG
ACTGCCAAGGCAATCGACAAAAGCGAGCTCGTCAGCGACTCAAACGATATGGACGACAGCTCCGCCCGGGACTTTGACAGCGTCTACCTCTACGAAGTCC
AACGTCAACACTAACATGAACTATGATGCAAATGGGTGGCTCAGATTCGCCTTTTATCTTCTGTCTCTCACCGTTCCCTATAGTGTTTTCCAGTGTTTTC
CAGTAACTTGGAAAATGTCCCTCCCCTGATCTAGAGCACATGTGCGTGGGGCtctcgcagcagcctcttcaGCCTTTCAACGGGAGATTTCCTGTACCCC
TCAGCAGATCCTCGTGACACGAGTGAGACCGTGGAGCTCTATCGTCCACCCGCAAGCACAGAATCGCCTAAGTAAATGCTACGGGGGGGTTCCTCACGGA
ACTCGAGACTACAGTACTTCTATCATCATCGCCAACCAACAGTACCGCAACCTACAGACATCTCAACTTTCCGGATATGATACTGTCgttcgtcttctgc
tgccAATGTGACCTTCCACGCTGCCATTGGTTGAAAGGGCACATTTCCCCAGCCAATCAAAGCACGTCGTATATGTGGCCGTGGGTCACCGCACAACTCA
AATCTTCCAGGAAGCGCATCATGTTCGCCCGAGTCGCCCGCGTCGCctcgctcgccgccgtccgccGCACGCcctccgtggcgctgcgtgcgctgcagAC
CCGCAAGGAGTCGTCGCTCACGTCTCTGCTCAACGTGCGTCCTCCAATCCCCAAAACTCCGGCCGCAATCCTCTAAAACCTAGCCTCCATGAGCTAACTT
TTACTACTTGACTGTTGTTTATtctttgctgcagcgc