Description :
From Genome Similarity Track
Location :
contig_32:122922- 130284
Sequence
7362 bases(100 bases per row)
CACGATGGGCAAACAATAACAGTAGAACACCAGAAGGTTCTGAAGCAAGCGCTCCCACAGTATTGGAAAATGGTGCTATTACTATTGACAGTGCCGGTCA
GTGTAGACATGAGCTGCATGTGTTGGTTATACGATGACTGCGGATAGTCTTTGTGTTTTGTTTACCACATTACATCAACAATTTTGCCAACTCGGTTTTA
CAATCTAAACCCCACGTTGTCGCAGGTCAAACGGCTACTACTGCCAAGTGTGTTGATCAATCCTATACAATATTCGTGAAGCTGCACGGCGATTCGTGAA
ACAGTTCTACGGCGGATCACTTGAATTACGTACACTTTGCGCAACAAGATGGAAGTAAATACCAGCTGCGTTGTCTCGTTTACTCGTGGACAATCGGCTA
TCCAAATTCTTCACCGCTAGAGTACGGCAACGTTGATTTCCCGACGAAACTTGTGCCGCTCAGTTTTGGAATAGTTTGAGAAGCACAAGCTGTTATTTCG
CCCCGTCATAAATGTCGTACCGACTAGTGCATGGCGAACACCAGTAGATTTAGCAAAGACAGCATTTATCATGCTGATCTCGTCAATTTTGTTGAGGAAT
GCTGGTGCAGTGCTGTTTATGCTGGTGTACGCTCCGTAGATGTGATGATGACATAGATTCATCTTCAACTAGCTTGTCCAAACTCGGAGCTGTCGTCACT
GGTGTCGACTCTACACAACTACAGTCACGCAGATCCCGGCTAGCATCATGATGCTGAGACTCACTACGATTTAAGATAGGCTCACCAGGACAAATGTGTT
GAGTCCTGTTTACGACAACTACAAGCCCCAAGAACAGCTCCCCCGGCTGCCATAAGTACAGGAGGGAGCCTCTCTCGTAGATTAACGCGTGTGTCCAGCT
TGTAGATGGAGATTCGCCCCGTTGTGCGTAAGAAGATTGTGATGGATCGCAACCACGCGATCGGTACAAAAATGCCAAGCACCATCCTAGATCAAGACTT
GCAATCCCTGAAGAAATAGTGCAGCCGGTCACGATATTAAAACAAACTGGGGCGAAGAAGACATCGATTCACCAGTATATTTTAGAGAATTGTGACCGTT
TGCCGACAAACCGTGTGCTTCGGGCATTGAAGGAAAAACAATTTGTTAACATAACTCGGGTTGAACGATTAAAGGAATAAAATAAAGAATCCAGCGAGCA
ACATGATATTATAATAAGGACATTCACAGAAACTGTAGACAGCAAAATAAAATAGTTCATGTTTTTCTATTTTATGCTGGTTTACCTAACCATCCCCCCT
CTTCTCTTTATACTGCTTCTGTTAGAGTGTTCATCCGTGCGTTGTAATGAAGACTCATCGCATGTGTGAATGTTTTCGTGCTTCTCTGAAGTTCTGTTGA
TCGACGCTACCCACGGCACTAACGAATCGAAGCACAAAGTGTTTTCGTTCATGGTACATAAACTCAGCAGACAGCTATTGAGGAATTTAAATTTCATCAA
CCTGACTTCAATTTGCGGTAGTAGTAGTGTCTCATGCCAATACATTGGTCGGATGATATCCATCCGGCTTATCAAAACCTGGAACTCAATCGACAAAAAA
TCCACCGTACTCTTTCTGATGTCTACCTTAAACATTTGTAGTGCTAAAGTCACAGCATTACGAGCTAAACTTTCAGGACTAACGGAGATGCACTCGCACA
TCACGCGAAGCACGCCAGCATCTACAGCTTGAACGAGGACAATGAGCCCCGATCAGCTGAGCCTGCTGGCGCTCCTCACGCAAGGCCTGCTAAGCCTCGG
CACTCCACGCCCAGGAACCTCCACCGTACAATAGCCACATATGAGCGCGGGACAGAAAGAGATGAGTGAGTCTCTGTCCCGCCAAACTGAAGAGGCCTTG
GAGAGCCGACCACGCGAAGAGGCAGAAATGAGTGGATCATTTCCCCACGCCAGCCCTTCCAGCTTGTCACCCATCATCATCATATTGCTGCAGCAGCCGC
CACGAACCCGTCCAGGTCCAGCTTTCGTCAAAGACGACTAAGCTGCCAATCGCCGGCGGCGACGATGTGGGCGATGTCGTAGGTGCCAGTCTGTTGGTCT
TGGACGCCCAACCGAACGACTCCTTCTTCGCAACACTCTTCGCCTCCTTGGGCTGCGACAGCCTCTGCGCCGCCAACTTCACAGCCTTACTCGTCAGCTT
CACAGGCGGCGCCGCCGATGATCAATTTCAATGTTGGCAATCCAATCACGCCGTCCACCGATTTCCGTTCCGCTAGTTCCGCTTTTATCGAACCTTGGGG
CAGTCTACGTGGTTCTGCAAAGTATTCTCTCTTGACGAAGTTTCTGATACTACAATTCGCCCTCTTGATGATATCTGGCGTTGGCCATGCATAGCGCGCC
ACGTACATCATCTTGGAACGATGACGGCTGCTGCGATTGCCGCTCTATGTTGCGCCGTATTCATTTTGCTTCCGCTAACGCTAGTCGCATTCTGAGCGCC
CCCGTCGCTTTCCGCCATGCTTCTTCGGTAGTATTCCCTCCTCGCCCCACGATGTGGCCAAAACTCGTGTGCTCGTGACTATCTACATCACCTATTCACA
GCCCTTTCTTCCATATACAGTGTCTCGCGCCGTTCTCGCACTCTCCCAAGGTGTTGACTGCAATCGTAGTTATTGCGTTGAACGCCGACGTCTGTCTCGT
ATTCACAGATGTCGAAACTCATACTGTGCTTCGTAACTTGCGTCAACCCGCTATCTTGTATACAACAACTCGGATATGTGTTTTATAGCTTGAATTCATA
GGATCGTATTAGCAAACTTTGATATCTTTTTTTAATGTCGTATCATGATGCTGCACCAATGATTTCTGTTGTAATTGGTTGGGATAAGTATGTACTCGGT
GATGGATGTTGTTAAGATCCTTGTGAGCTCGTCTGTGTTGACTGTGAATGAACCGTTGAGGACGATACCTATGTTTGATGGAGCCACCATCCATCAACCC
CAGACAAATTTGCAGTCACTGCAGATATTGTGTAGTCATCTAGGCAACCTCGGGCTGCAAGATCCAACGCATGTACCTGTTTACAAATACGAATCAAGAG
ATAGACCAGCAACATATTTGCTATTGGGTCTGCTGTATCGATTGACATGTGAGATATATAGATTTGAACTTGTCTCCCATCTACTGGTTTTGCACGACTA
CAAAACGATGTGTAGGCGAAACAGTGAAATCGGCTTTAGGAAGTCATTCAAGATCTTTATCTAGATTCCTCACAACTTGCATCACACGGTGCCAGTTTTT
CATAATCTTCAATGAAGACGTACTGAAAACTCCAACACCAGTGAATGCGACATGCATCGCGCGCAGGTGTGAGGAGTGCGCAGAGAACTTGGTGGTCAGC
CGATCCGCGAAGCCATTGGTACATGAGACCGTGCTGGTCACAGTCGCCAAGGTCGCTGTAGTGGCAGGTGAAAGGCAATGCTAGTAGATTCCGTCGTGGC
ATCATTCCAGCAGCAGAGGTGGTCCATCGAGGTGGCAATGGTCGTCGTAGCAGCAGAACCAGTGGAGGGTCAGAGACTAGCGGTGACGGGTTCGCTAACT
CCTTGGGTGGAATCCAGTGGCGAATGCATTTTGTCAAGTCGAGCATTTGAACGACCCCGCTAAGGCTCTCGACCGACTGCGCTCGTACGACGTTCTTACA
TTTCCAACTCTTTTCCCGCGTGGGCGAGCACAGCATCATTGGGCCGATGGCGATGAGCGCTATGGTAGTAAGCAAATGGGCTCTTACGAGTAAAATGGTT
GCGAGAACGGCAGGCGACAGTTTCTAGGAGTACGGACCACCACAGTGTGGTGGATGCCGCATTCACAACTGACGCGAATGAAGCCACGTTGGGCGGATAA
CGAAGGAAAGAATACAAACACATGATTAGGATGCAATGAGAGAAGGGGGCGTCCGCCGCACAGATCCTGATAGAACGGAAGTTAAAACACAGCCCCCCGG
CCATCGCAGAGGCTCTAACAAACCTGTCGTGGAAACAAGGATACAGGATGGGATGGGGCACGGCGTATGTGGTAAATACCGCTATTGTAGGTATTTTAAT
AAAAGATGAAGTGTATTGAGTTACTGCTCCCTACTGCTCGCTGAACTCTGATAACCATCTCACGTTGGTGTGTGCACTCTACGCAGTATTGATCGCCAGA
TTCTCTCCGCCGGCCATACTGTCATCCCTTCTCTCCGAATGCCTTCTCGCCTTCAGTGCTGCTGCTCATCCTCCCTCTTTTGCATCCTCATTCTCGTGCC
TGCTGTCTTCTACTCATTTCTGTACGTTTCCTGTGAGTTGTTACCCCCCCCTCCGCACCTCTGTATATTCCTCTGCATCACTCCACATCTGTGTCGTACC
TGTGTTTCTGTACATTGCGTACTTCGCTAGTCAGTCGGCTGACTTATTATGCTGTCGATAATAGTGCTCCCAGCTCTGGACTTCGCGCTTGTCTGCTAGC
CTTCTTGCTAGCCGGTATCAGTTCGCGCCTTCGGCATTCTCTCTCTCTCTCTCTCTCTCTCTCCCTGCATCATGCCCAGGATGAGGGTACTGTCCCCCAC
CTCTTGTATTCCCTCCCAGTGCTGGTCAACTGCTTCACCAGGAGTCTGTGAAGGCCTACGAATTCCACCATATTATTGGTAGTGGATCTGTTACTAAGGG
GTGTGGCCGCAGCCCACACAGCTTTCGAGCCCCTTTCGTTACGGTTAGCTTGAAGCTATATCGTATGCGGAACTGATCAGAGATATGATCAGACAGCTGC
TTTTTGGTGATCTGATGTGGGATCTGAAAACGAGTGATGAGTAAAGAAAGAGTCTTTACTGAAGGTTTGCTTTGGTACGTGCGTTGCTCAGTCGGGAAGT
TGCATCAAGGGACCTATGTGGAGATGTTAACGGAGGGTGGTGAAGGTGACGACCCAGCTGCAGACCATGCAGACACAGAGCATGCAGCGGCAGACATGCA
CGCGACGAGCTACGACACCATCACGAACATGGTGACTGGCAACGAATACTTGGACTTGCAGAGTGACCAAACCCGACAGCACGATGAACGTGGAGTAAGC
TCTACACCAACGCGCACGGGCCGTACAACTTGCTTCTACAGAGGCTACAAGTACACACGTGCGTGGGCGTCCATGATGAAGACTGTGTATCGCTGCTCAA
AGTTTCGTCAAGGCTGCCCGGGAAAGCTGAAGTTCAAGATTGCTTCCATGGGTTACTCATGCGTCAAGGCCCACACGTGTTGCACCGCAGTTGTTGCAAG
CTCTGTGAGAGACATCAGGGACGAGATGGGATCTCAAGCTGACCTCCTGGCAATTGAGCACGTTGCATGGCCTGCGAGGCAGGTTTGGGAGGCGTTACGG
GATCGCTACTACAATGAAGAGAACCCTGATGTTGTTCGTGGACTGTCACAACAACAGGTGGTGCAGCGTGTGTACCGCGCGAGACGTCAACACTACGCTG
GCAATGTTCATGGCTCGATCGAGATCCCCCCGCTATCATTAGCACTTGGTGAAGCAGTGCCCTTTTTTCAGTTTCACTACACAACCATACATCGTGACGA
TTATAACAAGCCGACACGCCTTCTTAGATGTGCGCATCCTTCGCTTGTTGCATTGCTTCGCTACCATGGTACTGCGCTATTTGTCGATGGGACCTTTAGC
TGTGTCCCAAGCGGCTACGCCCAATGCGTGGTGTTCATGGTTCACGACCGCGCTTCAGGCGTGTTTGTTCCAGTGTTTTACATTCTCAGCACCTCACGGA
CTGCAGACTCGTACTGAGACATAGTCCATTTTGTTGTGCAAGCCACAGACCAGCAGATTAGTCCCGCTGAGATAGTCTGTGATTTTGAGGCTGGGCTAAT
GGACGCTCTTCAAACGCAGTTCCCGAACGCTATCGTGTTGGGGTGTCTGTTCCATCTGAAACAGGCACTATGACACGCATCGCGATTCCAGAGGAAGAGT
ATACCATTGCTATGACGCGTGGCATTTTAGACGTGCTGACTGTCATTAAGCCAGATCGGATCGAAAGAGGCATTAAGTGGGTTAAGCGTGAGATCAAGCG
GCGTTGTGCTGAAGCTGGGAATGTCTACTCTACTGACAAGTGGGGTGAATCCTGGACTGACTTTAATCGCACTTGGATTGAGCAGTACTCTATCGACCTG
TGGAATGTGTTCAGTCTGGATAATGAGCTGATTGCGCGGACAAATAACCCGTTGGAGAGATTCAACAGGAAGCTCAGTAGCCGATTCCCGGTGCTGCACC
CCTCGATGGCGACTTTCGTAACGGTGATTAAGACGATCTCAGCTGAGTACATTCGCCGCGTTGCTGATGCTCCTCGTGGTCAAAATGCCCTTCACCAACC
GTATGATAGCGAAATTGAAACTCAACAGGTTGTGGTTGTGAGGAGGGAAGGAACAAGGATATGGAAATACGGCGGAGGGATGAGGAGAGAAGGTTCACCG
AGGGGAAACTAATTTGATGTGGGCGTGTCCGGAATCGCAGGTACTCTGTATGGCCATGCTCGCAATGTGGGGGCGAGACAACCAAACAAGGCCTGGCTAA
AAAGCAATTGCGTGCTGCTGGGTTTCGAACAATTCATCGGAGCCCCTACGTTCGGCTTACTTGACAAGAGATGGTATAATATTTGCGCTACGGCTAAATC
ACAGTCGTTGCAGAACACCAGTGTTTTACTTCTTGGTTTTGTCCTTCTCTCGAAGCAAGTTAAATAGTATTTTTAGCCAATCGTCATCTTCCGAATTAAG
TTGGTCATTTATAATCTTTTTGTGACTGAGATGAAAGATACTAAGCGTAGCTGGTCGGTTCCGTCGAGCCTTCAATTCAACGTCGATCGAAGCAAGATCT
CTCTCGACTGCACGAAAGTAATGTTTCCTCAGCTTCAAGCTTGAGTTATCAAGCTGCTGAACTGAGGCATTGTAAAGATCAGTAGCCACCGCGGTACAAT
CCTTCCACTAATATAGCTTATTGTTCAGTGCTAGCTGTTCACTGTATAATTGAAACTCATTCTATGAAAGTTCGACGTCATGTCATGACTTGTTAAGGCA
ATGCAGATCTTCGATTTCTTTTCTAAGTACTCGTTTGTTGAAGTGTCACGTTCCTAGCACGGTTCACGGGAGTTCGGACCGCAGGAAACGGTTCACTTTG
AACCGTTCTCTGATTAGCTGAGTAAACTTCGGTGGTTGTGAGGACACCACAAGAGGACAACAAGGGGGGACACTAGGGAGTATCGTAAGAAAGACATTTA
AATCAAACTAATCTACTCACTTCGGATTTGCCTCCAACCACAAACCAACAGGTTAACAGCCG