Description :
From Genome Similarity Track
Location :
Scaffold_36:122901- 124469
Sequence
1568 bases(100 bases per row)
GCGCAAGAACAACAATAGTTTGTAAGCAGAAAAAAGAACTCGGTCTGGTGTGACATGAGTTATTGAAGCATCTACCAAATTGATGTAGTTGGGTTTTTAA
CAGAATGACAACGACAAAATGTCCGTAAATACGTATATCGGTTGGTACCGCTAAGACACTGCATACATTTTATTACTGTTGACGGTATTGGATTCGAGTA
GTTTTGGGAGTATCTGCGCACCCTGATGTGTGCATTCCACCCTAATACAGCGCCCACTTCATCAGGACGTCCACTCCACCGTAATACGGACCCCTGCCAT
AATACGGTTGCCCCACAACTTGAACCCGCAAAAGCTAAATACTCCTGGGCATACCCTGAGCACCACTTTCTGTAATAATTTACATAGCAGCACAAGAAAG
CTTTTATCATCACGGCCACCTTCATCAAAACAAGGTTGTGATGCTATGCTCCAATTCTAACACCCGTAAAGGTCAATTGTAGTCACCAGAAGTTGACGCG
TGCGTTTCGCGGCAGAATCAAACGCATTAAATTTCTACCGATACGCTCTGCATACTCACAAAGAGTGCGGAAAAAGCCATAAAGTGACGAGGTCTTCTTT
TGCAAGCTTGAGTTAAAAGCAAGTCCTCCAATATCGTCTCTTTCACCCCATAATATATTATTGGAGCTTACTGTTCTTAAGACGGGTTTTACGAGTGTTT
AGCATCACACCACTGGTCTCCACATCAGCGCGTACAAGCGCACCCTTATCTAGGAGTAATCACACAGCCGCAGATATCACTTTCTGTTGTATGGAGACGA
ATATAATTGTGATAGTTCCATACGTACTGTCAACACTGCCTCTTTCCTCAAACATTATCGAAACAAAAATTACGAGCGTGGGAGATCCTCCGGCTGTATA
TGTCACTAGCTAAATTTGCAGGGATCGATCAAGTGCAAATCTATCGGCTTCGGATGCATTAAAGACAGTTTCTGGCCTTATCGTGGTGGCTTCAGCACGC
TTGAGTGTGATTGTGAGTGTATATAGCTATGACGACTGTAACATTGGACGTCGCAATCAGGCATGAATGGACACGACCCCTCCCCCCTTCTGCTACGGCC
ACACTCCCTTGTAATGGATCTCACCTCAAAGATCTTCACACAGTAGGTTCTTGCTAGCCAAATGGATCCTCCCACCCTCACAACATTGTGTGAAGGAAGT
ACAAAACGGGATCTGAGCTTTTGTAAAAGGTGGAGCTGTATTGAGGTGAAGCGTTTACTCAATAAGGGAGCGGTGTATACTCTGCTATGATCGATTTCGT
GTCACCCGCAACATATCGGTTAGTACCGGTATATTTCCGCTCTATCGTAGTATCGGGATACGACGAAGGAGGTGGTGGATGAACTCAGTTTGTTCCGTGA
TTATCCAGTCACTGCATCGTACCCACCAGTTTGCGTACCGAGCACAACAAAACGTACTGCACCACAGTGACTGCTTACAACTTTATCCGACATCGTTTCA
TATCTTGCTCAAGGCATCTAATGATCAGTCTTGAGAGCTGTCAACTATTCCCGTTTAAGTCTACCGAG