Description :
From Genome Similarity Track
Location :
Scaffold_327:12290- 13725
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_327-snap-gene-0.960S ribosomal protein L13

Sequence
1435 bases(100 bases per row)
GCATAGTGGGGCCAAGTGAGTCCAGGGACTGGTCCTCCTTGGCGTTGGGGAACCACCAATTCTGGAGCTCTTGGGTGCCGTTCCTGTCGCGGCCGATTGT
GAAGCGCCAAGTTCCAAATTGACAGCAACTTTCTGAATAACTTCCCGCGAAGGTAAATGCTCGGATCGGGCTACTGGAGGTGTCCTGCGCCTGCGAATGT
GCTGCCAGCGAATGCGGGCGGTCTCGCTATGTGATGCGCCCGCGGGTTGGTTTGCGAGCAGAGCGTGCGCAGGACGTGAAGATCGTGATGAAAAACACAT
GAGGACAGGTCATTAACGCGTTGTACTTGTGGCTTGTGTCGGCAGTTAATCAAAAATGGTGAAGCACAACAACGTTATCCCAAATGGTCACTTCCACAAG
GACTGGCAGCGTCGCATCAAGACTTGGTTCGACCAGGTAAGCAATTTTACAACATGCATACTCAAGGGACTTAGAGAGCGAGAGAGGGAAAGAGAGGCGT
GCGAGCAAATACGAATACCAGTGAATGAGACTTACAGCACGAGAAACAATCAGCGAAACAGATATTGGAGAGCAGCTATCGGTATGAAAGCGTGAATTAC
AAAGTCGAAATCACAGCACAACATGCACAACCAGTCAGCAGCAGCAGCATTCATTCCAGTACAGCATCTCATGATGAGCCACAGCAAAAAACAACAACAA
CACTTCGACACACGTCTACAGCTACAGTCATTGTGCGGAAAATGGAGATACAGCAACGCACAGCTGTCATCACGACAATGGCGCCTCCATGGCTCATTAC
TGGCGACTCTCTTTTCCACTCTCTACTCTGTCCAAGTTTCCAGTACCCCTAACCAATCATGTGCTCACTCTTCACGTTTTTGCTTGTCCTAACAGGCCGC
CAAGAAGAAGTCTCGTCGTTTGAGACGCAAGGCTAAGGCCGCTGCCATCGCCCCTCGCCCAGCTGCCNNNNNNNNNNNNNNCTCTTGCGCCCAGCCGTGC
ACTGCCCAACCGTGAAGTACGCTTCCAAGGTCCGTGCCGGCAAGGGTTTCACCCTTGAGGAATTGAAGGAAGCTGGCATCAACCGCAAGCAGGCTCTTTC
GATCGGCATTGCCGTGGACTTCCGCCGCACCAACAAGTCGGTGGAGTNNNNNNNNNNTCCAGGCCAACGTCCAGCGCCTTAAGGCGTACAAGGCCAAGTT
GGTTGTGTTCCCACGCAAGAACATCAACAAGCCAAAGAACGGTGACGCTTCCCCAGAAGAGACCAAGAACGCTGTGCAGCACACTGGTCCTCTTTTCCCA
ATTGCCCGCTCGGTCGTCAAGTCGACCACCGCGGTGATCACGGAGGAGATGAAGGAGGAGAGCGTGTTCAAGACGCTCCGTGTCGCGCGTGCGGATGCGC
GCATCTTCGGCAAGCAAAAGAAGCGTCTCGCGGAC