Description :
From Genome Similarity Track
Location :
Scaffold_135:122885- 125547
Transcript NameFunction/comments
Hyaar_Emoy2810729hypothetical protein

Sequence
2662 bases(100 bases per row)
ATCACGATGACAGGCCTAGACTATCGTCTGCCCAAGAATTACGGATTCTCGAATTAAATTTAAATGCGAAGCTTAACAAATAGAAGCCTTCGTAAGTGAA
GCATACACCATTGAGTTGCCTTTCGGTCAATGACATCAGTTTATAGACAGTAGAAGTGGTGGCATCAAAATCTGTAATCTACAGCTGTACTCACTCGCGC
AGTGCTCTTGCAATCCATTTCTGCCATTAATTGGTAGCTCAGCCTGCTTTCTTAATTTTGACGAGATGAGACTGTATACATCTTACTTAGGTAAACATCT
TGCAATTTAATTGATACGATCGACATCACCAAAACTTGTTATTCACGATGGCAGCTGCCAAAAATAGATCCACCAAAACATAACCCGTGCCAAACTCATA
TGACGACTGCACTCGCTACTAGCAACATTGTTCATACAGCTCCGTACCTACAGTTTATCCATCAGATGTGCGAGGTAATCGAATTTCTTGAATCAAAGCG
GAAGGATGTGCAACCTTTTGCAATGTGCGCAGACGCCCCTAGGCGCTAATATGACAACCTTGCGGAAATAGCCATAAATACACGTACCTGTTCTTCCTAA
TGTGACCCGTACTGGTGGCCAAAACATTCTCACGGATTTAGTACTGTTGTTGTTGTCTGAAAAATCGGTATGGCTTTCCACGTTAACACTGCGGCTGATC
TTATCGGCGGTTATACGATTGTGAAATGATGATTTATCGCGGACAGAACATCAGTGGTTGTTAGAGGCTGTATGCTTTGTACCTGGTCGCCAGTGCACAA
TGTATAAAAGCGTCTCCTGATTGATTGGAATCGTAACTCTACCCCCGATGTTGCTCCGATCTGTCTTCAGTTGCACTTATCATTAGAGCGTCTTCAGCAG
TGAGTATAACTTAACTTTTTGTGCGCCAATCAGAGACCAGTATAACTTCCTCTCAAACTTATACGCAAAAAACTTCACAGCAGTCAGTATAACTATATAA
TATAAGCTTGCTCGTCGTCCGAGAGGTCGCGCACGTACTTGGCCGGGTTGCCCGCCCAGAGTTGTCCCGCAGGAATACGACGTCCAGGCGGCACGACGCT
GCCAGCTGCAAGGATCGTGTTGGACTCGACGAGGGCACCATCGAGAACGATCGTGCCCATGCCAATGAGCGCATTGTTCTCAATGGTGCACGAGTAGAGC
GTGCAGCCATGGCCGACAGTGACGTCGTTGCCAATGTGTGCGCCTGGGGCCAAGCCCGGACTCGTGGAGCTCGCTGTGTGGATGACTGTACGGTCCTGCA
CGTTCGTGCGGTTCCCAATACCCACTTNNNNNNNNNNGTACGCACAATGTGCTCTCGAGTATACGCCTCAAGCTGGCTCTTACTCGTAATGATCTGCTGA
CGTCTAGAATAGGCACGTGTCAATCGAAGATCAAAAGAGGAACTGAACTTTTATTTCTTAGTTTATCTGTAATAAACCTCATTCAATACCTAACACTAAG
GTTAAACTAATTCGCATATTAATTTTCAGTCCATTAAAGATTAATGGATGGTACATCAATCTGTCATCAATGGATGATTGAGATTATCAACCACATCAAT
TATCACAGATAAAACTTGGGATTGTATATCACATATACAAGGTATATCCCTTTAGGACGATAACGGACGTGTGACCCCGTTACACCCTCCCCCACCAGAC
TGACGTTACCACTTAACGTCAATTGAATCATTACCTCATCGAGGCATTTGGCGAAGAGTAACCTCACGGTTTGTTCAACGCGTCAGACATGGCAACACCA
AACGAGTCTTCGGCCTTTTACAACCTCCTCGGTATTGAGGAGGAGGAACTGGACTATGGCGGCGATGTCGAGTCCAAAGTCAGCACACTTGTGCGCGACG
ACATGTCGAGACAGGCAACTAATCCGTTCCCTGAATGTATGGCTGCGAATACACGAACAGCGCTGCACACGACACCCGGTATGAGGTCGGCAATCATCAC
AAAACCACTCAACGAGGAGCAACAGCAGGTGCCCCAACAACAGGAGAGCACTCAGAGCAGATCTCAGATCATGTCGACACTCGAAAGTCATACTGACTAT
GTGTTTACACCTCTCAGTTTGGAGGACCGTCTCCGACAAACGACTGGTCAGTCTTTGGCATCGTGGACCATTTGTCCGGCAGCCAATACACCTAAAGAGA
TTGAAACAGGCAGGGTATTGCGTGAGCAGCACCTGGAGCCGTATGTTATGACCTTAAGTCAATACAAGGTATGGATTTTAGACCAAGGTCATGGTGTACT
GGTTTCACTGATTAAGGGTATCCCCGTACCCTAGACGTAGGGGAGCTGGCTTCTGAAGAAGACAATGCGNNNNNNNNNNGATGACTTAATAGGGCCATCG
GAAAAGACGCGCTCATGTCGCTGTAGAGCGATTGCAGATTATACTTGCATCGCACATCTCAGAAGAGATGTACGCCCTACCCCAGGGCGAAGAAAGGGAG
TGCACCTCTCTTTGGATGCGTTGAGTCTTGTAAAAATAACGCGGACACGGGTCTCCCACGTGAGGCTTGAAAATCCTGCTTCACGAGACAGATTGTACAG
TCTGGCTTTTGCACCAGTTAAGGCTCGTTTCTCAAACCTATCACGAGCTGTGCTAAGTTTCC