Description :
From Genome Similarity Track
Location :
Scaffold_31:12285- 14498
Transcript NameFunction/comments
Physo_134291hypothetical protein

Sequence
2213 bases(100 bases per row)
CCGTCCTTCAACCTGGTTTGCGTGGCGCAATCAAGATCTTACCTCGGCGCGTTTTGGTCGGCGGGGGTTAGGGTCGGCGCGTTTTGCTCGGCGGGGTTTA
GGGTCGGCGCGTTTTGCAGAACCGGGTGCGCTGGTCGACCCGTCGGATGATTACGCGTCGCACTGGATTCTGGCACCGTGTCTCACGGCCCATCACCCAC
ACCGACTTTCCCGTCGAGCTCGGCCCTGCGTCGCGCCCATCAATCCGCGTCGCGATCCATCAGCCGCGTCGAAGTCCATCACTCGCGTCCCGGCGCCTTC
TTCCTCCGGCGCCCGGCGCGCCCACTTCTTCCGCGGGGTACTACACCACATTCGTCCCGCTGCCACGCACGCGCACTCCCCAGGTGGGTGTGTCGTCGCA
GAACCTGCCCCGCGCCTTGGCTTCGTCTCGACACCATCGCGTTTTCTGCCCTCGCAGTCCGCTTCGCGGTACTCCAAGCTTCATGGCTCGCCGCCACGAC
GTCGACGTCAACGACATCGACCTGGAGGAAGAAGAGCTTGACACCAACGAGCTGGCTGCGCGGTTTGTGCCCTCGGCGCGCATCGTCCTCGCCTCCCCGT
CGCGCCCCAAGTCCAGCTTCCGGCTTCAGGCGCCCCCGTCCACTCGGTGACTGCTCTTGTCGCCGACGCGCACACTCTCCAGCGCGAGAACCAGGAGCTG
CGCGCCCAGTACGAACTCGTCTCAGCGCACAATGCGGGCTTGGCTACTCACGCGTCCGTGCTGCATGACCGCAATCTCGCGATCTTGCATCGTGCTCGCG
AGGGTTATCGCGCAGGCATGATCCGGCTCGAGCAGGCGCTCCTCTCCTGGGAGCAGGCCGAGCGGGACTACGCCGTCCTGGAGGACCGAGTGGCCGACTT
CCGCGCTCCTGCTACGCCGCCTCCCTCCACCGTGCTGCTAGCGCGGCTGTTTGCTGCACAAGGCGAGCGCAACGACGCGCGCGCCGAGCGTGACGACCTT
CGCGTCGACCTCGCAGCCGCCCAAGCCGCCCTCGCTCCTGTCCAAGCGCGCGTGGCCGCTGCCGAAGCTGAACGAGATCACATGCGGCAGCTCGTGGCCA
CTGCCGAGCAGCAGCGCGACGCCGCTCTCGCTGAGCGTGACCGTGTGACCCGCGTTCTCGTGGTCGTCGAGCAAGACCGTGACGGGGCCCTCGACATGCG
GGATCAAGTGCGTCGAGCCTCCACGGCCCTGAGACGCGAGCGAGACGCTGCTGTCACCGAGAGGGACCAGGCACGTCAAGCCGTGGCCGCCCTTGAGCAG
CGGCGAGACGCTGCCGTCACCGAGAGAGATCAGGCTCGTCAGGCCTTGACCGCTCTGGAGCAGCAGCGCGCCCCGGTCGACGAAGAGCTCCGCGCGGCCC
GTGTGTCGCTTTCTCAGAGCCGCATGGAAATCGAGGCGGCCCAGAACCTGAACGTCCCGCTGCAGAACGACCTTCGGCGCGTCAACGCGCTCTTAGTGGC
CCACGCCGAGGAGCTCCGCCGCGGCGCGACGCGTATCCACGAGCTGGAGGAGTCAGTGGCTACTGCTACGACTCTCCGTGTGGCCGCCGAGTCCGAGATG
GCGCGGGCTCAAGCCGGCGAACTTTGCGCCACATCTCGCGCGGCGCAGTATCGAGCTGGGTGGCTGTCCATTCGGCGGTCGTCTCAGCAGCGTCGAGGAG
CGGTCGGCGCCCAGACCCATCGTCTCAGCGCTCGCGTCGCCGAGCTGGAGGAGGAGCGCAACTTGGCCATCCGAGAGCGCGACGAACGCGCTGTGGCTTG
GCGTCGGATGCTTCGAGACGCGCGTCGGGGCCGAGAGCTGGCGCGGCGGGTGCGCGACGAGCTTGCCGATCGTCTCGCCGGCGTCGTAACGCGTGTAGGC
GGGTAGATCGACACCGCTGACCTGGTCAGGCGACTCAAAGCCACTTTCACGGCGGAGATCGACGATGCGATCCCCCTCCCCCCTGCTATTCCTACGTCCG
CAGCAGTTCCTGCGGCATCCGCGGTTCCTGTTCCTGCTTCAACTGCGTCGAGCTCTGGTACCCGGGCGGGCTCGTCGGCTTCGACGGCAGGCTCGACGAC
TGGCGCTTGCCCTCCAGCAGGTCCTTCGGGCTCCCGTCCTGTTCCGACTTCGTCCGCTGCCTCGTCCTCGTCGGGTTTTCGGCGACCTCGACACGGCGCG
TCGAGTCGTTCGG