Description :
From Genome Similarity Track
Location :
Scaffold_306:12285- 13685
Transcript NameFunction/comments
g13245.t1hypothetical protein

Sequence
1400 bases(100 bases per row)
TGGTTCCTAACGGAGCAGGAAATGACTGATTCGCGGGGTGGTGTGCCTAGGAGTGATATGGCCACGTACTCGACAGGCAACGCGGTGACCTCCTTCACGG
CGCCGAATGATTTTTTCAATGCAGCCTACGACGACCTTGCGTCGACGAAGGAGGGCGAACGTGTTCTGCTTGCAGCTTGGGTTGTCGCCCTGGTTCCGCT
GAAGCCTGACGTGGACCCGACAGGTTCGAAGACTCGCTTCGACAAAGTCATGGCTGATGTCGTAAAGCGAGGGGGGAGTGTCAACATCCTCGGTTGGGCC
AGTATTCAGCATCGCAGCAAAGTGATCGACATTCGCAAGACCATCAACGAGATTGCAGAATCACCAGTTAACGGGGCGAAAGCGGTGATGATTTTGGACG
ACCGCCTCCCCTACCCATTATCATCCCACCACCAGAAAACGTTGGTCATCGCAGCCAACAGCTCCTCAGACAGCGAAGAGCAACCGGTGGCATATGTGGG
CGGAATGGACTTCACCACAGGTCGATGGGATACCATGTACCACAATGCATCGGCAATTCGCGACGCAGCCAACGTCTCGAACGGCTACAAAGGCTGGGAT
GACAGCCACCTTCGTATCCATGGACCTGCCGCGAAAGACGTGGCCAACAACTTTTTGGCTCGATGGAATTCGAAACACTTGCCCTGTCAAGACCTTGACG
ATGATCTGCTTGACTACGCAAACCCGCCGTACGAAAACTTGCCGTTGCTGGACTACGCGAGCAGCAACTCTAGCTCCAACCTCGGTAATCAGAGCGTACA
GATCGTGCGGACTTTCAGCTGTGAGTACAGCCACAATGAGTTTGCCCCGCACGGTGAGAACTCGATCTTCAAAGCCCACCTCAAAGCCATCAAGAACGCG
AAGAACTTCATTTACATCGAGGACCAGTATTTCATCCTCGTGCCGGAGTTGCTGGACGCACTGTTGGAGGTTTTGCCGACAATCCAGAGACTGATCGTGG
TTACAAACCCTCAGACCAAGGTTTTCGGCACCGGAGGGTACGTCAAGTACAGCTACGAGATGGTTACGCCCCTCCTCGAGGCCTTCCCGAACAAATTCAA
TCTTTACACGACGAAGACGGAGCGAGAGATTTGTGTTCACAGCAAGCTACTCATCGTTGACGACGTATTCTTGTCAGTGGGGTCGGCCAACTGGAATCGC
CGCAGTATGACGTCCGACTCGGAGATTGCTGCAAATGTCATTGATGGTGGCACGGTGGAGTCGCCTGACGGTGTCACTGTAAAGAAAATGGCTCGGGACT
TTCGTATCCGCAAGTTCCAGGAGATGACGGGGTTGAGCTACGACGAGCTGGACGCCATGACATTTAGTGAAAGTGCCGACAAGTTCGAGGCCGCTGCACA