Description :
From Genome Similarity Track
Location :
Scaffold_29:1228199- 1231441
Sequence
3242 bases(100 bases per row)
CGTTGCCGCGTCACTCGAGGACAAATCAGCGTCCGAGATCTCGGACGGATGGTACTTCTTTAAACGTTCGACGTCGAACGTCGGATGTAGCCGTAGTGTC
GAAGGAATGTCCAGAGTGTAAGCGTCACCAATGGCCTTGATTACCGTAAGCTGCCCAATAAAGCGCGGAGCGAGTTTGTTCGCGCCGAGGTTGATAACCG
CAGCGTTTCTGATACCTTCAGTCGACAGGAGCACTCGTTCGCCTGTCGTAAACGTGGCCGTGTCCTTGCCGCCAGTCTTATCTGCGTTCTTCTTCTGCTT
GTCCACTGCGTTTTGCAGTGCGTCTCGAATATAGCGGGTGACCGCTTGGCGCTGTAATACAAAGTCGGAGACGACTGCGGAGTCAATTGGTCGCGCCGCA
TGCTTCGGCGCGTAGTAAGCCGGCGCAAGTGGGCTCGATGCGGAACGTATTACTGCGCTGACCGACGTGAGAACTGGGGATACACTCGAGATATCATTAG
CAACTGGTGTATGTACCGGTTGACCCAGTACCGGTGTTGCCGCCGGCGACATCGGAGCTGGAGTAGACGGCTTGTCGGCAGCTCCTTCCCCACCCAGAGT
GGAGACACACGGCGCTGTGGGATGGCCCACTGCGAGGAGAGCAGGGACACGCGGATGTCGCGCGTTGTTAATGAAGAAGGGCATTAGCCCAGTCGACGCG
TGTACCGCGTTGTTTAGCGCGAACTCGGCCAGAGGCAGACCTGAGTCCAGCTGGAGAACGACGTCGCGTAGCCTCGAAGGACGTCTTCGAGGACGCGATT
TACGCTTTCCGTCTGGCCGTCCGTTTCCGGACGGGCTGCTGTGGACATCAACAGCTTCGAGCCCGGTAGCTCGAAGAGCTTCGTCCAGAAGGCCGACGTG
AAGCGCGAGTCGCTGTCGGAGACGGTGGATTAAGGAAGGCCATGATGTCGGAAGATCGCATCGATGAAGTGCACCGCGGTATCTGCCGCGGTGATCAAAT
CCGACACCGGAATCAGGTGGACCATCTTGCTGAAACGGTCTACGAACACCAAGACACCTGAACGTCCTTTAGCATCGGGTGGGAGCCCGAAGACGAGGTC
CATCGACACCGAGTACCAGGCCACCGGTAGAGGACACAGGGGAGCTTGCGAAGACGAGACAGGTTTCACGTGCTGGCCGATCTCGCGGGTGCGCACCCAC
TTATGTACCCATATGTACAGGTGGGGCCAATAAGAGCCGCGTGATACAGCGGCAATCGTCTTCTCGCGACCGAGATGAGCGCCTAGTGGGGCATCATGAA
ACTCATGAATAATCCGTGAGCGCAGATCCGGTTCGTTAGGGATAGCGACACGTGGGGCATCGAAGTTGTCGATGCTGTACGTCAGCAGCTCGTCCTCGAT
ACGATATCGGTGGATTTTGTTTCGTACAGAGCGGGAAAGGGATCCCAGTGTGTTGGCGCTGGGAGAGCGGAGATGCTCCAGGATACTGGAGTACGTCGAG
TCATGCTCGTAAGCAGCTCGGATTTCGTCTCGGGTGGCATTACCGGGGAGACGCTCGTCAGGTTGACTCCTGACGCCTCGCACGTGGCTTACTCGTCTAC
ATCGTCTTCATCGAGCGAAGCTTGTCGACCCAATGCACCGCGTATCGTCGTAGTCGGGACGCCGAGACAAAGCATCGGCGAGAATGTTGTTCTTGCCGGG
CTTGTAATGGACCACGAAGTTGTACTCAAAGAAAAATGAAAGCCAGCGGGCCATCCTCTGGGAAAGACGAGGACCCTTCATCGCTCCTCAGCGATGCATG
GTCGGTGTACACCGCCAAGGTATCCCCACCCAACATTTACACTCTGAACTTGATCAGAGCGTAGCGCATCGCAAGGAGCTCCTTGCCGTGAACAGAGTAG
TTGCGCTCCGTCAGCTTCATCTGTCTGGACTAGTAGCTTACGACACGCTCTCGACCTTCTTCATCGAATTGCATCAGCGCACAGCCGATGGCGAAATCGC
TCGCGTCGCAGACGACGTGAAAAGGCTTCGAGTCATCCGGGAACCGCGAGGATTTGGGCCTTGGCGAGATTCTTCTTCACCAAGTCGAAGGCGGCTTGAT
GTGCGAAAGTCCACGACCACGACACATCTTTCTTCAACAACGAAGATGGCGGCTCGATCAATCCGGCGAAATTCTTTGTGTACTTGTGGAGATAGTTTGC
GAGACCCAGCCACTGGCGCAATTCAGTGGGATTCTGTGACGTAGGTCACGCACATATCGACGACACTTTCTTGGGGTCGGCGCGGACGCCGTTCTTGCTC
ACAAAGCAGCCAAGCACCGGAATCTCCGGCGCGCAAAATATGCACTTCTTTAAGTTGGGATACCGCTTGTTTTCGCGCATCACGTGGAAAACTTGCCTCA
GATGTTTCATGTGGACTTCAAGCGCTGAGGCCTCCCTCAGCGCGGATGTGTACGAAGATGGCGTCGAAGTAACTCGGTGCGAAATCGCGGAGCAGGCGCA
GCACATGGGATATCATGCGATTGAACGTGGCGGGAGCAATCTTCAAGCCTAGTGGCATAACAAGCCACTCCCACAGCATACCACTGGGAGTGCCTACCGC
TGTGAGTGGTATGTTGCTCAGCGTTATGAGAGATTGGTAGAACCCATCGGTCAAATCGATGGCACTGAAGACCTCACTACCCGACATTGCGTCGAGCACC
ATGTCCTTCCGAGAAGTCGGCGTCTGGGCAGGGATGGTAGCGTCATTCAGCTTGTTGAAGGCATGGACGATGCGCCATCCGCCCGTGGCTTTCTTCACGC
AGAAGGTCAGACTGGAGTGCGGCGATGTGCTCTCACGCACCTGACCCGCCTTACGGTGGCTCTCGAAAAAGTCATCGATAGCTTTACCTGATCACGTGGG
AGCAGCCACTGCCATGTCACACAATACTTCGAGCCAGGCACGAGATCGATCTCGTGGTGAATTTCTCGGACAGCTGGTAGCTCAGCTGGGATCTTATCCG
GAAAGACATCTTCATATTCGCGGGCGGACTCATAGACTGGATTGCTGGCATCGCGTAGCACTTCCCAAGGTTGCGGTCCGAAGCGCTCCTCGCGGGCCGA
CTTCGGTTCAGCGCTCTTCGGGCGAGAGGGAGCGTCGTCATCGCTGACTGCATTCACTTCGAGCGACGCCGAATCGGTGTCCATGATCAGGCATACCTGT
TCGATTTAACCGTCCTTGAGGTCGCGAAGGAGATTTTTCCAG