Description :
From Genome Similarity Track
Location :
Scaffold_13:122812- 144001
Transcript NameFunction/comments
Phyra_75472PREDICTED: uncharacterized protein LOC100784837 isoform 1
Phyra_75473inositol polyphosphate multikinase, putative
Phyra_94166dTDP-4-dehydrorhamnose reductase
Phyra_75474PREDICTED: uncharacterized protein LOC101860584
Phyra_75475haustorium-specific membrane protein, putative
Phyra_75476PREDICTED: protein eyes shut homolog

Sequence
21189 bases(100 bases per row)
CATAAGGTGGGCCGGGGCGCATGAAGTGCCCATGTGCGGCGCGACCATCCAAATGGCCTCCCGTCAGAAAAGGGAGCTTGAAGGCTTCGTGCACAGGCGG
TGTAAGGCGGTGTTTTCCTCCCAGAACAAGAGCGCGGCCACGGGGATGGATGCCCGCGCGCGTGTTAATCCGAGTGGTGGCACCGCGAGCGGCGAGCGTT
GTGCGGCCGACCTCGAGCGAGCCCGCTCAGCGAGCCAGGCGCCACTACGGTACCGTACGAAAGCTCGGTCCGCCCCGCGCATGGTCGGAAGCCCTTCTCT
TGCATAGCGGAGACCGTCCTGTTCGTCACCACGATCGCCTTCCACACCGGAAGGACGTGCTTGGAGCTGTTGCCGGGCAGCACGACGAAGCGAGCGATTG
AGCGCCATTGCCACGGCCGCAGCGCGTGCTCTCTACGTGTATTGCCGCCGCCGTTGACGGTCCAGCGGATCCCCGCTCGGATCCTGCGAGCCCCACCCAC
CACAGCGTCGACGAGCTGCTGATGTCATCGGTCCTGCTTTGCAATCGTGCTGCCTGTCCGGAAAACCAACTGCGGCGCAGAGGCCCGACGCGCGCTATGC
GATACGCTAAGAGCCGGGCCGCAACGATCAAGTTGGGAACGGCAGCAGCCAGATGCTGTTGCCGCCGGAGCTCACCACGCCTTGATGACTCGGAGTGCGG
GTCGAAGGCATGGGCGCCGTAGCTCACGATACTCACGCGGCAGCAGGCTACTTGCCAACTTGCAGCGGTGCAACGGCCAGCGACCACGGTCACCTCGCCG
CCGCGGACTTGTAGGGCCATCGCGTTGGCTCTTCTTTCCGCTACATTGTACATGGAGGCAAGCCTGCATTCCTGAAGTGTAAGGAAGGGCTTTTCCTGCC
ACGCGCGACCTGCCTGCACGCTGCCACGCCGCCGCCGTCGTGTATGAAATGTGCCGCGCGCGATCTGGCCATAACACCTTTGCATTGACGAATGCCGTTT
TATCGGCCGTGGCGAGAAGGGCCACGAGGACACCGCCCCGAAATGGACACCAAAGGCAACACCGCGCCAATGCTAGCAACAATGCTGCCACCGCGCTGCT
CATGCAATACAGCACACAGTGTTGAAGCGTGGCGGTGAGGGCGTCCAAACGCGCTCGACGGACGGCGGCGCACATCGTGCTGGAGCGCCGCTGTCTGTTA
TCACGGCACGGCGTTCACATCGGCCAGGAGCAGATCCAGTCGCGCTGTAATTGCCTTTGCGCGCGACCAGGCGCTTGCCTTTGCGGCCTCGTTAAAAGCC
CTTTCGCGTGCACGTGCCGGGCCGGTACGTAGATATTTGAATTCCGCCAATGGGCGGCGCGCTGCTCCGCGGGAACGCGCAGGATTGGTTCATCCTGCCT
GCTCTCTTATCACGGCATCCGACCAGAAAAAGAGCCTGAGATGGGCATGGGACACGCGAAGGGATCGGGGTGCAGAAACCAGTGCGACAGTTGTGCCTTT
GCGACCGCATCGCCCGCCCGTGATTAGACGGCCGACGGCGCGGATGGCGGTGAAGGCGCCGCCAATGTGGTGCCGGCGCAGATGAAGGCGTTGTTGTGGG
CTTGCCTGTCTCTGAGTCCGGCCGGACCCGTCACATCAACTCGACGCGTGCCCCGAAAAAACGGGATGCAAGTTGGGGCAAACACAACTGGACGCGATTC
AATCTTTTTGAACCGAAGATGCTCCCCTAACCCACGCGGCTGCCCCTTCTTTCCCGGCCGCGCATGACCGGGCGTCTTGTCCATCCGCAAAAGGGGGAGC
CCCGAGTGAGTGGTCGTCCTGCGCTTACCATTGTGTTTCCTACCAGGCCGTTGGTACTCGCTTCGTCTTCGTCTTCGCGGTGCCCGTCTCCGCCAAGGGC
CAAGTATTTTTTCTGCCGGAGCCGACGCAGTTAGTTTTATGGCCTCCACGTCCTCGTCCTCGGCGTCCCAGTCCACCAGCAGCAGCTCCAGCACCCGAGC
CATGCAGCCGCAAGATCCCAACCCCGCCGCGCTCGACGCCTCGGCCGCACAAGCCTTCAACTACGACCCGTCCTACCAGCAGTACGCGCAGGAGCGCGCG
CTGCACGACCAGGCCGTGCACAACTCCATGGCCGCTGTGAGCGGCTCCGCCAAGCCCGCAGGCGCGTCCAAGGAGTCCGTCGTCAAGACCAATGACCCCT
CGTCCGCCAGCGCGTCCCCCACCAGCGTGACCAAGGGGGCCCCCGGCTCGACCTCGTCCACGACCAGCGCGTCCTCCTCCACGGCCGCCAAGACCGCGGG
CGCCCCGGCCCGCAACGAGTCGCTCAAGTCCAACCGCCTCTGCACGATGCCCGGCTGCACCAAGCGCGTGCGCTCCAAGGGCTTGTGCAAGGCCCACGGA
GGCGGCCGTCGCTGCATGGTCGACGGCTGTGAGCGCAGCAGTCAGGGGCAGGGCCTTTGCATCCGCCACGGCGGCGGCAAGCGCTGCACGCAGCCAGGCT
GCACCAAGGCTTCCCAGTCCAACGGCCTCTGCAAGGCCCACGGCGGCGGCTTACGCTGTCAGAGCCCCGGCTGTACGAAGAGCAGCCAGGGAGGAGGCTT
CTGCCGCGCCCATGGCGGCGGTCAACGTTGCGAGAAGGAAGGATGCAACAAAGGCGCCCAGCGCGGCGGCTTCTGCGCTGGTCACGGCGGCAGTCGCTTC
TGCCAGCACCCGGACTGCACCAAAAACGACCGTGGGGGAGGTTTCTGCGCGGAGCACGGCGGCGGCAAGCGCTGCGACCACCCGGGCTGCAACAAGCCCG
CCCGCAAGAAAGGCAAATGCTCGTACCACGCCAATGCTGCCAAGGGCAAGCTGCCCAAGGACCAACTCGCCACGGCTGGAGTGGCCGCAGCTTCGTTGCC
GCAGCACATGATGGATATGCGACAGATTACCACGCCGACGTTCGCGATGGGTGTCAAGGATTTGCGTGGGGACCAAATTGACGCGCAACGCGCCAGCTAC
GTGCAGCAGCAGCGAGCGGAGATGGACATGCGCTACAAGAGCTACGAGGCGCAAACCAACGCCGGCCAGTACCTGCAGATCCACGCCGACCAGCGATCGT
ATGAGCCCATCAGTTTGCAGGCTGGTGGCGCCCAGCGCCACTACATGCCGGTGGACAACGGATCTCTGCCTCCGGTGTCTGGCAGCATGTACAAGCCATC
AGACCGTCAGGCGTACGCCTCGCGTGCCCCAGAGCAGATGAAGAACCCGTACTCGCAGCACTGGGCCGCCAAGCCAGAGATCCCACAGCACCACCCGGAT
GGACGGGTTGACTATTTCGATGTGAACAAGGAGCAGCAGCAACAGCAGCCTCCTGGACACCACCTGCCTTACTCGGCTCAGTCCGCACAGTACCACCACC
ACCTGAGCGCCGCTGACTCGGCTGCCGCTGCTGCAGCCTATGGCCAGCAACCGCCTGCTCAGCGTGCATACTATAGCCAGCAGCCCCCGCAAGCTCCCGC
ATCCGGTGACCAGCCAGCGCCCCAGCAACAGCAGCAGCCCAACATGATGTACTATTCGGCGAACGGGTACCCGCAGCACCAGATGCACAGCATGCAGCAA
CAGCAGCAGCAGCAACAGCAGATGCAGATGTTATAAGTCCGGCAATGCCACCGTGCAGTCGCTGAACGGGTCTGCTCCTTGCACGTCGCGCAATATGAGA
CGAAGCTGACGAATTGAGTGCAAGACGGCTGTGAGGTGACTGCACGCTGTAATAGAGATAGAATCAACCCGCCATGGATCGGAGCTCCTCGAACTCGAGG
AAGCGGCAGAAGTGTTTCGTGCCGTCGGATAGGGAACGTAGCCTTCCTCCCTACCAGTTTTGACCAAGCTAAAGGAAGGATCGAGCGAGAAAAAGCATTT
ATCCACTTCAACACGTCCGTATTCAAATGTTATCTGTAACTGCGGGGCGAGCCCATGTACAGCGGCACCGCCGACATCTTGGTCTCTTTTGAGTGCAGAA
GCCTGTCAGAAACATCACCTCGCCCTTCTCTTGCTTGTACAAGCCCGGACTCTTTCGGTGTGTGTCCGCCAGAGATCGAGCAGCGCAGGCCAAAGGCTGC
ACGCAAGAAGCTTCACATGGTATGTACAGGACGGAGTTCACATTTGCTTCGGTTTGCTAGCTCTAATAGTCTGGTCCTACACTGAATTGGGACGGCGTGG
AGGCCCGTCGAGCCAGCACCGCAGCCTCGTCCTCGTCGTCTTCGTTGTTGCCGAGCTCCCCAGCGTCGTGCTGCAGTCTGGCTGCAAAGCTGGTGGCCCG
TCGTCGGGGCGCTACGGCCGCGGGGCGTCTTCTACTTGGACTATCTATTGACACGGCGGCGGTGGGGCCCCGCACGTCCTCGAGCTTGGCGTTGCGGGCC
GCGCCTCCCCGTCTCGACTGCAGTTTGGCCTGCAGGTACGTGCCGATGGCCGACGTTGGCAGATGCAGCGGCCCGGGGGACGACACGCGGGGTGAGCCAG
CCTCCTGGCTGTCGTCCAGAGCCACGCGGAAGCTACCCTTGCCCGCATAATAGTGGCGATAGCACTCGATGAGTTCGTGCTCCATGCCCGCGTACGTCTC
CAGTAGCTGCGCGGCTGAGGCCTCATTGCCCGGCTCGTAGACGTGCAGCAGACGCTCCAGCTCCGCCTTGTAGGTGGCCGCGTCTTGCTGGTTGTCGCGC
CGGGGACTGCTCTCGAGAGGGCTCTGCGGACGCATGAAAAAGAAGCTGCGGCGGATCGGGCGAAAAACGTAAAATGGCTCTTGGATGCCTCTTTGTGCGG
TGCACAGTTCTATATTTTGATTTTTCCATCGACTTTAGCTTCAACCAGCTCCCAATGGGGAGCCATCGGCCACATGGGCTTCAGTCGCAGTTGGAGCTGC
TCGACTGGCAGTCTTTTTCAATGAGTGGCATCCGCTCGATTTGCTACAAGATCAGCCTTGATGCTCACGACTGCAGGGCCTGGGCGTCGCGCAGCAGTGT
CTGGAAGCACTGGATCAGAGTGGCGATGCCTGTTCGCAGCCCTTCGTCCCGCTTGGGAGACGCGTGCTGGGTCGCGTGGGCAAAGTCGATGAGGCGGATG
TCAGCTGCGTAGGGCTCCGACCCGGTGTCGCTGCCTTTGACAGACGCCCCGCCGTCGTACAGGAAGAGGAAGGAACTGGCGATGAACTCCGTTCCTTGCT
GCTCATCGAACCACGTCTTGAACTGGTCGAGGCGACGCAGAAACTGAAAGCAGACAGCAGTCGATACCAGATACGAAGAGCGTCAGTTGCGAGTCTATCA
CAAGAAACAGCACTGCAGTAGCCTTACAGCTTCCAGCAGTTGAATAGTCTTGGGCGTATCTTCTGGCGGGAAGTAGTTGCGGAAGGCCGGTGCAAGCTCG
TCCACAGAGGTGATGCTGCGACCAAAGTGCTTGTCGAACTCGACATACCGCCGCTGCTTCGGGTCAAACATCTTGATCCCTTGAATACGGAAGCCCGCCG
TCTCCTGCAGCGGGAACTTGGACTTTTCGTACGCGATCTTCTCGGCCGTCGCGTCCTCTTCGTAGGACCGGGTGCCCATCTTGACGTCCATAATGCTCGG
CCACTGCCTCCCCCACGTCAAGTCTTCCAGAGCTAAATACTCTGCACCCAGCCACGATACCCAACAGCAAATTAGTACACTTCTAGAGCCCAAAGTTCCT
CAACTTGATCAACTTTTGCCCACGTCCAGGGTGCAGTCCATTGATAGGCGTCTCCTCCTCGCCGTCCTGCACTTCAGGGACCTCCACGGTGCCATAATAA
CCGGGTAGAAACTGCATGAGACTTGCAAACTCAGGCGAATCCTTCTCCGACACGAACACGCGCTCGTAGAAGCCGTGCTCGCGCTGTCCACGCTGTTTAC
TCTGGAAAGGCTTCAAGATGCGGCCGTTGTGAGCCTTCAGGCCTGCCACAGAGAGCGCAAAGGCGACGATATTTACACCATTAGAATACCAGAAAAATAT
TCATTAACTAAGACTATCGCTGGGTACTTTACTCGTGTTGGACGTGGCGTGGCCGCCCACTTGGTGTGCCATCTCCACGAAGCATTTGGTGTCCGCCATG
CTGTGCCTTCAAATTGTGATATAGTCCGTAAAGATCCCAGCTCTGATTTGCAGCACCCTATTTTGTGACGAGAATGGCGCGCGTGCTGGTGCTGGGCGGC
ACAAGCTACGTGGCACAGTTCTTGCTGCAGAGGCTACTGCAGAGCGAGTCGCTCCGTGTAGCTGACGGAGATGTATTGGGTGACATATCTGCAGTGGCAT
GCACAATGCGCAGTCAGCCATTCTCGCCACTCCCCAATGGGTTTGTGACGGAATCGGATTCTGCAGCGCAGTCGACGCGGACTGTGCGCGTGTACTGGCA
GGTGGACATCCTGGACTTGGGAGCACTGGGAAATTGCATCAAAGAGTTCCACCCGACCGTCGTGATCAATTGCACAGGTAAACTAGTACTGGAGATTGGT
GAATGATATTTTAAATGCTGATCTTTGCTGGCTGTGTGTCGCGCAGCGATTTCATCGCCTGCACTTTGCCAGAAGGACTCGGAGAAGGCACACGCTATCA
ACGAGGTGCTTTGAGCTGGCTTTTTTTACGGACGGCGCCTCTCTTGACATTACTTGTGTTGATAGCCTCGGGAGCTTGTTACCTTACTGGACCACCTTCC
GTGGCGAATTCGATTTGTGCACTTGTCAACGGACTTTGTTTACGATGGAAGGCAACCGTGGGGTGAAGGCTACGACGAAGACGCTGCAGTGTTGTCATCG
GAGTTGTCAGTGTACGGTGCTGACAAACTTCGGTTCGACCAACACCTGATGGAGCAGAGCTCGGCAAACTTGCAAGTGTTGATTCTTCGTATCGCAAATG
TGGTTGGCCCGGCAGCTCCATTGTTCCCCGATAGAAGCGCACCAAAGTTCATGGAATGGCTGCATCACCAGCTCTTTCAGTCCGGAACTGCTACTGTGCC
ACTGAAGTTGTGGCGTGACGAGTTTCGCTCTTACCTTTATATTCAGGACTTTGTCGCGATCCTCTTCAAGATGCTGTCGGCTCAGGCTGAGACGCCCGCT
ACTCTTGTCAACGTCGGTGCGTTCGCTCTATTCGATGAACTTTCGCTTTACAAGACTTGCTAACGTTCGTGCAGGTGGTGTGGAGGCACTTTCACGTGTG
GAACTCGCGCACAAGTATCTTGCTGCTTGCACAAGGTACAATTCGAAAGCGGTGAATGCAGTAAAGAGAGAGATCGTGCCGACCGCGCGAGCACAAGTCG
ACTTGGGGTACCCTTCTCCGCTCAACACGAAGCTCAGCACAGCACGGCTCGCGCACCAACTGCCAACCTTCGCCAGGACATCGACGGATCAATTCCTGGA
CGAGATTAGCCACAGCTTTCTTGCTTGAAAAGGGAACGCTGCAATGTTATATGCTCAAGCTAACGATGGGGTAAAGAAAAAGATGACCAGAACGATGCCA
TCAAGTAGTCGCCATACCTACATACGAAAACGCGCCCCACTCGCGCAGGTGATAGAGTCATCCAGTTACTGGATCTCCATCACGTTTCCCATGCTCTGCC
GCCCTTTCTCGAAAGCTTGCACGATTGGATCCTCATTGTTGCCCTTGCTGCCAGACGTTGACGTGTAGACGAAGTCCGCGTCACATAGGGCAATCGCGTT
ACACGCTTGGCTGGGGCTCTTTCCCTTGCGCATGAGCGACACCAGCTCATCGAACTTGGAGGAAAGCACGTCGCAACGCGCACGGGGTGGTAGAACCGTG
CATATGGTTTCGAGTGTCATCTTCGCTTCACGCAAAGCCTTCTCATTGTCCTTGGCGCGCTCCAAAAGATCGGCAGTGTACTCGCAGAATAAGCAGCCCA
CCGACATCGACTTCTCCGCAGGCACCTCCTCCACCGCTGCAGGACCACACGCTGCGATTCGCGTGCAGATGGTCTCCACATCTTCGTTATTTTTCAGTGA
ATCAACGATCATGTCCTGGTGCTTCATCAGTAGCTCGCACTATTAACGGACAAACACAATTGTTGTCAGGCGCATTGCAACGCAACATATGAAAGGGGCG
ACTTCTTACCTCGCTGGAATCTGGGATCAAGCGACACACCGAGTTGATTTCGCGTTCGAATGTTGCCAAGCTGTTAGGACGAGTAATCAAGGACGCAAGC
AGCAACGTATTCTGCTGACACGATGCACACCTCGAGGGCAAGAAGTCCGAGCCCTTAAAGTCAAGCAGGCCCGACACCAGCGAACTGGTACCTTGAGTTG
CCGTGCAAAACTTAAGTGTCTGGCAAATTTCTTGCGGCTCCTTTCCAGCTTGTAAATCGGTCACTGCCTCGTCGAACATCTTAAGGTCATCGTGGCACTG
TCATTTAAGCAAACAATATATCAGTATCATCTCACATAGTTGTACAGAAGACTTCGCTGTTCTGCATCACTTACCGTGTCGTCGGCAGGGAGTAGTTCGC
AAACGATGCCTGCAGCCTCTCGCATTTCCTTCACTTGCTCCGGCTTCTGGTCAAGTGCGTACTTGAGCACAGTGACAATGCCACTGCAGTAGGCACATGT
GTTGCTTTCCTCGTCGTTGTCTCGAACGGCGATCATGTCAACTGAAGGCATTGCAAGCTTGGCCATAGCAGGGTTGGTGTCCACCGTGCAATACTTCAGG
TCGTGGCAAATAGCCTTGGGCTGTTCGCCCTTCTGCAGAGAATCGACCACAGCATCGAACTGCTTTACAAAGGAGTGGCACTGTAAACACATACATAGAA
AAATTAGCAACCTCCTCGATGCATGTCAGTTGAGGCAAGTATCGTACCTGGTTGTCGCTCGGAAGCATTCCGCAAACAACGTCAGCGATTTGGCGAATCT
GCGCGATCTTACTCGGGTCTTGAGCCACGGCCACCTCAATGATGGACGCCACTTGCGTGCAGAAAAAACATCCATCAACCGACACTTCCATCGATTCCTT
CATCATTTGGACCAACACCGGATCGTAAGCCGACAAGCTGCTGGGTGAAGAGGCCGGGGAAGGCAACGTGTTGTTTGCCGGGCAATAGTTCATCGATACA
CAAATAGCGTGCGGGTGCGTCCCGTTCTTCAGCGAATCCAGCACAAAATCAAGCTTTGCAATGTACTTGTGGCATCCACACTCCTCGCCCATCAGCGCAC
AAGCAGTGTCCGCCAACTGCTTGATTTGACCGATCTTTGTGGCATCTTGTTCATAAGCAGCTTGCACAAGAGTAGTCGCATAGTCACAGAAGAAACACGT
CTTCGTGTCACCCTCAACAGCATCAGGGCGACTCGCGACAATCAGAGCCGACACAGTGTCAGCAAAGGAATACTCGTCAGCGACCACGTCCACTTGCTTC
TTACAGAGTCCGATGGTCTTGCAAATCTCGTGCGGGCGTTTTCCCTCCTTCTCGAGTTCCACGATCTTGTCAAAGTTCTTATCCACTTCATCGCACTTAC
AGTCAGGCTTTGCCAGCTTGCACACGTTCGTCAAAATGGTCTTGACGATCGGCAGCTTTCCCGGGTCAGTCTGATTGACGTGGTGAATGGCAATACCAAC
ATGAATGCAGAAGGAACACCCATGGTTGTGTGGCGGGTGTTCTTCTGAGCTCAAGACCACCGCATTTCGTTCACTGTCAGCGAGAGCTGGCTGTTTATCC
ATCGCCGCAGTGCAAAACTTCAACTCCGTGCAAATTGCCTTGGAGCTCATACCCTTGGTGATCGAATCAATGACAAAGTCGAACTCCTTCACGTACACGT
GGCACGGGTTGTCTGCACCGAGCATATCACAGATCATGTCTGCGTACGCGCGGATTTGGCTGATATCGGTACCATACTGTTGAAGGGCAATTTTAGCGAC
AGTGGTGGCGAATTGGCAGTATGTGCACTCTGTGGCGTTTCCAGGGGGCCACTGTGAAGCTACCACCACACCCTTCATCTCGTCCGCAATCGAAGGCGCA
CCTTCCTCCCAGCCTCGTGTCTTGTTGCAAACCCCAAGTGACTTGCAGATCTCATGCGGATGCTTGCCCTGTTTTTCCAGTTCCACAATCTTGTCGAAGT
TCTTGTCCACAACATCACACTTGCAGGTTGAAGGCACCAGTTGACACACGTTGGTTAGAATGGTCTTCACGATCGGCAACTTTTCAGGAGACGTGTGGTT
GACATGGTGAATCACCATCGCCACCCGTGAGCAGAAGAAACAACTGCCATGGGGGTGCGGGCGGGGATGAGGAGGGTGCGGTGGGTGCTCGTCATGTGGG
ATGACTCCCATCTTATCACGCTTGCCATGACCGTGGTGGCCGTGGCGGCCTCCAGGCCCCTCCATGCCAACATGCGCATGATGTCCATGTCGGCCATTTC
GCATCATTCCGACACGAGGGCTTTCGTCCAGAAGTGGAGGGCCATCCATGCGTTCAGCAGAGCAGTATTTCAGCGCCTTGCAAATTTCGCGAGGGTGCAC
TCCCTTCTTTAAGGAGTCAACGACCGTGTCCAACTGGTTGACATACTCGTGGCACGGGCTATCATCTCCCAGCATACCGCAGATCATGTCTGCGTACTCG
CGAATTTGATCAATCTGGTCAGGTTGCTCTTGCATAATAACCTCCACAACCGTTGTAGCTGCGTCGCAGTACACACACGTTTTATCATCTCCATGCACCC
GATCCGATGGCGGCATATCATGCATGTTTCTTTTGGGGCAGAAATCGGCTGCTTGACAAATCTCGCGCGGGTGCTGGTCTTGCTGCACCAGCTCGATAAT
GTAGTCAAAGTTAGCCTCCACTTCCTGACACTTGGCGTCCTCGGAAGCTAACTGGCACACGCTTCCAAGGACTGACTTCAGCATCGGGAGTTGTTCAGGA
AATAGGCTGTTCACCTGGTAGATTACTCCGGCCACACGAGAACAAAAGAAGCACGACTGGTCCTTCTCCAGGAATTCGGGGGTGGTTAGAGCGCCATCTC
CGATTGTTTCGAGCTCTTCCGGATACGCTGGAACATCGGAGATCTGACTGTCACTGCCACTGTCGGGCGAGCACATGGCGATCCGAGTGCACACCACGAG
CGGGTCCGTGCCGTGCTTGAGCCAGTCCACGATAGCGTCGAAATTCTTCAGGAACGTGTGGCACATGGAGTCTGTCGACATGGCGTCGCACAGGTCTCCA
ATGATAACTCGGACCTGCTGCACCTGCTGCACTTCCTGGCTCAGCGCCTGGTCCACCATCTGCACGAATCTCTGGCACAACTTGCACGACAAGTTGTCGG
CTCCTTCCAAGTCTTCGACTGTGGCCATGATGTCACACACCTCATCGTCCGTCTTGCCCTCCTGCAAGAACTCCTTTACCACTTCTTCCGAGCTCAACAC
ACGGTTGCACTGTAAACAAAACAACATACCAACATCAATTTCCCCTCCCACTTCATCAATGAAACTGCATCCCGCACCTCTTCCACCAGCTCGGAACGCT
CGAGATCATCGCACGAAGCCGCCCCCCACAGCTGCAGCGACACCACGTCTAAGGCCGAGCGAAAGTACTTCGCGAGCGTCTCCGTCTGCTGCTGCAGCTC
GTCCTGCTCGTGGATCTTCTCCAGCGCCTTCAAGCACGCCGTCTTGCGTGGATCCTCCTCCTCCTCTTCAATGATCACGATGACGTCAGCCTCCTGGGGT
TCCCCGAGGCTGAAGAATTGCTGCAGCATCTCGCTGGAGCGCTGGAAATGCTCGTTCAGCACCGCCATGAGGCCGGCGGTTTCTTCCTCCTCCTGGTCGT
GATGGCAGGGCATTTCGGCGTCCTGGCGGTGGCCCAGGCCTGGGCGCCCGCCGTGGTCGGCACTTGCGACGGCCGCAGCGGCCGCCAGACTCGGCAGCAG
CGCGTACACGGGGCGCATGGTTTCTCGCTTCCCTCGACTTGTTCTTCAAGCTGGGTCGAATCCTGTTTGAAGCGGGGCGTGTGACTCCAGAGGAAGAGGA
CGGATGGCATGGCGAGGTAGGAGTCCGCCTTCCACCACCAGTCGAATCAATAGTGAGATGGAGAGAAGATGGTTTTGTGTGTGCCACATTGGTACCGCCG
TTGAATAGTAAAAGGCTCAGGATCAGGTGGAAGGAGGAGAGGTCGACGATAAGGTACTTGTCGCAGAAGGAATGCTGGTTGAAGTGGCCAGCCAATCGGC
TGCATTTGCACCAAAGCGGATTTCAACGTAACTTGTACCATTTCAGACATTTCCTCTATACTTTTCTATCGGCGCTGTTCCTGAGGCTGAGAACTAACTC
ACGTTCAACATCGCAGTGAGCTGCAAGCTGCCGCTTTGCGTCGAGCGAGGCACCCACAGCAACAGCGAACCACCTCCCGTTCCGGGAAGACGTAGGATAC
CCGGACGCCATCGATCCAGATACAGCGTCTTACCTCCCAGTTCCGCTACACTCGACGTCCATACCACAGTCCCACCTGCCGAGACGGCCACCTTGTCGAA
CTTGTTGCCACCAGAGTGGATATTCACAGTCACATCCTCAGTGTCAACACTTTGAAACGTGATGGTGACAGTGCCATCGCCGACCTTGGTCCAGTTGCCA
GAACTGTTGGCGAAGGCGTCCCCGACCATCCTGAGACCTAGTGCGTCGTTTGCACTTCCATCGTCGATTTCGCCGGTGAATTTGGTCGGTCCACAAATGG
TCTGAAAGTACTCGGAAATCACACTGTCGATATTTGTTAGATCCCAAACAGCGTAGAAAGTAAGCGCCTTGTCAGCGATCTTGTAGGCATATTTCTCTGC
AGTGAGAAGCGTTCCGTTGGGGCTGGTGCCTGAGCGGATTAGGTCGTCCATGATGCCCCAAAACTCTTGCGCAGCGTGTCTCGCGTTGCATAAGCAGCAT
CCTCGTCCGACTGCTCAATCAGCTCTTCCATGCAGTTGTTGGTGACGATGGGGATCTCGGTAAGCACGAGGGTTGACTGGCTCATGGCCACACGAATATC
GGCCTCGGAAATCTCCGGGTCTTTCCTACGCAGGTCTGCCACATTCATCCAGGTGCGGTCCAGCAGGCGTTTCATGTTATACCCGCAGGTGGAGTTAGAC
TCCAATGCTGACTGCAGTGAAGTGATGTCGGACTCGTCTAACGAATCCAGCGGCTTGTCTAACGCGATTCTCTTCATGAATATTGTAAACGCTGCCCAAC
TGGCAACGATCGCACCCTTGTCGCTCACAATTTCTTTCACGAAAAGCTCAATCGTGTTGGTCACTCTGTCGGTTGTCTTGATACTCTCCGACACGTGCAT
ATCCAGGCATGTGCAAATGGTGATAGGTAAATCGAAAACCACGTTGTCGGTCTGGTACAGCATCGTTTCCAGATACTTGTTCGTGGTGTGCGGGCTGGAT
ACTTTAATGGTGCGGATGAATTTTGTCAACTGCTTCACCAAGTTTATTATCTCCTTGCCGCACTTGAAGGCGATGCGCACACCCTTCGCCATCAGCTTGA
ACTCGCCGTACAAACCGAACGTAGCAAGGGAGAGTGCCGATTGTGCAATTACGGATACCTTGGACACGATTTCATGCACGCAGTCGTCGTTTTGCCGTAT
GCATTCCAAACCGCATCTTACCGGGTACGCCAGCGGACATTCAGCCCAGCAAGCGTCATGGTGGCTATCAAACTCGAGCGGGCAGGTTTGTGCAATATGA
GTCTCTCGGTAGCACGCTGTGTCAGAGCCACCTCCGAGTGCAGGACCCACCCAATTGGTATACGCTGACTCAATCGTAGAGATGGTTGCCACACTCGTGG
AGCCGGAGGCCATCGCGGTGTCTGATTCTTCGTCGTCGGCACTGTCTAGATCCCCCTCGTCGTCGTCTTTTAGTAGTTCATTGTCACCACGGTCGCCGCC
CAAAGACCTGTTGTCGTCACTGTCGGAAGCGCCGTCGTGGCTCGGAGTCGCAGTCAAAGAGCCGGTAGTAGTAGGTGTGAAACTTGCAGCATCCACGAAG
GTGTATGTCTGCGCAGTAGAAGTCGCGATGCCCGCACTCAGCAGTGCAACGACTTGGATCAGCTTGAGCATCTTGATCGATGCCATTTTTTTCACGAGCA
CAGCCCGTAGCGATTTCTGCGCGAGTGCAAATGGTAACGTGTCTGTAAAATGAAAAATAACCGTACGGTGTGCATACCAAAGGCTATCCTAGACGTCCGT
CTTGGTCACAAAAGTTTGCTGCTGCGAGCCATTTGTTCGTAAGACGACGCAAGCTACCGTCTAGCAAAGCTGCTAGGAAAGACCGCGAAGGCGCAATGAG
ATTGTGGCCACCAGTCTGGTGAAATACCACGACTTCGATGTTATCATCGATTCCAGCGCAAAGCCTAACCTGCACTATAATTCCCTCAGAGCAGTTGCTG
CAGGTAGGCGATCTTCGCTTGGTCATGCGACTAGCATTCACTATAATAACAACCCGAGTGGCAGTACTAGCAAATGATTAGAATGGTGGTTTGCAAAAGA
TAAATTGTGATGTATGCCGACGGCATTGCAAAGCTCACAAGTTGCGATTACTTGCCGCCCGATTTTTTTGTTGTTCGTTCTCAAACCACAAAAAAGAAGC
GAACTTCAGGATTGGCGATGCAGATGGGCTGTGAGAACGTAAGTAGTGCTCGCTGCAGTGCTCACAGTCTCCCACAAAATAGATTGCATTCGTCCCGTTC
GTCTCAAGCAGAACTGGCAGTATGAAATGTAACTGCACGTCTAAATACTTGTCACTGCGCAATTTCATTCACTACATCGTTTTGCCGTTTTCTAATCGCT
ACACGTCCGCGGGAAGTGATTAGAAAATGATGATTACAGCTTCTGCTCGGAACCACCAACGTTGCCTACGCAAGTGAGACGCGGCTATGGAGCCCGTCTC
ATGCATTTCGTCGTGTCATTGCCAACGCCAGCGCCAGCGCAGCGATGGCGTTGCAAAGTAAGCCCGCAAGGGTGTGCAAGCAACATGAACGACGCGAACG
ACACCTCTACACAGTCATGTAATAAGCTCAACCAGGGACTGGATGAAGGGTGTTGTATCCGAGTAGACAATCCTGGTGGAGCGCTAAGAGGTTTGTTTTG
TAGTCCGCAGAGAAAGTATGACGACCACACGAGTGAAACAACTCCATGAATGCAGGTGCTTTCTGTTAATGAACTGGTGGCGCCAAAAAAGTCACAAAGA
AATAATACCTAAGCGACTATAATAAAACTAATGTGGCCCAAATGCCACAAAAAATAGATGACATACAGGTACATTTGCGATGGCTAGCAAGCAATGTCAT
TTCTTGTTGATAACTTATTATATTATTTGGATCATAGTTTCATACTTCTACTGACTCACTACACTTAACAGAAATGAAGGTCATACTAACTCACATTGAG
CATCGCATGGAGCTGCAGGTTCCCGCCCTGGGTTGACCTCGGAACCCACAGCAATAACGAACCGCCCCCTGTTCCGGGAAGTCCTAGAAAGCCCGGACGC
CACCGATCAAGATACAGTGTCTTGCCTCCCAAAGCCGTCATGTTCGAGGTCCACGTCACAGTCTGACCCGCAGCGACTGCCACCTTGTCGAACTTGTTGC
CACCCGACTTAATGTTCACAGTCACGTCCTCCGTGTCAGTGCTCTGGAAGTTGATCGTGACAGTGCCGTCACCGATCTTGGTCCAATTTCCAGCACTGTT
GTTGAAAGCAGTATCCACTGCCTTCAAGCCCAAGGCTTCTTCAGCAGTCCCGTCATCAATATCGCCAATGAATTCGGTGGGGCCACAAATGGTCTGGAAA
AACTCGGAAAGCACACCGCCAATGTTTTTCCTCTCCCAAACAGCGTAAAACGTTGCAACCTTGTCAGCGATTTTGTACATGTACTCCCCAGCCGTCAGAA
GCGTGCCGTTGTTGCTCGTTCCAGAACTGATCAAGTCGTCCATAATACCCCCAATGCCCTTGCGCAGTGTATCTCGGGTCTTGTAAGCTGTAGCCTCGTC
CGATTCTGCAATCAACTCTTCCATGCAGTTGTTGGTCATGGTAGGGATTTCGTACAGCGCGAGGTTTGACTGGCTTATCGCGACGCGGATATCGTCCTCG
GAAATCGCTGGGTTCTGCCGGCGCATTTCAGCCACAGTCATCCACGTGCGGTCCAGCAACCGCTTCATGTCGTATCCACATGTCGAGTTGGATTTCAGTG
CGGTCTCCAAAGAAGTAATGTCCGATTCGTTTAATGAAGAAATTGAAGCACCCAGCGTGATGTTCTTCATGAAGCCCGTGAATGCACTCCAACTGGAAAC
AATGACGGCGCCATTGGCGATGATTTCCTTCAAAGCGAGCTCGGCTGTGTTGAGAATTCTGTCAACAGTCTTGATCTGCTCATCCACTTTGATGCCTAAA
CAGGCAGCGATAGTCACTGGGACGTCAAAGACCACATTGTCGGTCTGGTACAACATTGTCAGCAGTTGGTCTTTTGTGGTTTGAGGGTTAGATACCTTGA
CAGTGCGGACGTACTTGGAAATCGACTTGACCATCCCCATCATCTCTTTGCCACACTTGAATGCAATTTGGATACCCTTTGCCATTACCTTGAACTCGCC
ATATACGCCGTACGTAGCGACAGATAGAGCTGCCTGGGCTACGGCCGACACCTTGCTCACGACTGCGAGCGCGCAGTCGTCATTCTGCCGGATGCATTCG
AGACCGCACTCAACAGGGTAGGTAAAAGGACACTGGGCCCAGCAAGTTCCAAGCTTTCCGTCGAAACCGATCGGACATGTCTTCGCAATGTAGGCCTCTC
GATAACACGCCGTGTCAGCTGCGGTGCCGAGAGCTGATCCTATCCAGTTTTTGTACGTGGAATCGATCGTACTGGTGGCGTTGAGACCGTTGCCAATGGT
GAATCCTGCGTTCGCCGAAGACGACGTCCCAGACCCGGTTGTCGCCACAGAACCATCCACTGCTAGTGCGGAGTCGCTTTCATCGTCACTGTCGGAAGAG
CTGCCATCGTGGTGTATGTCGTCCTCACTGTCTACGGACTCGTCGTCGCTGTCCTCGTCGCCCGTTGACTGGAAGGTGACGGTTGCGGTAGTATTTACTG
TGTAGTTGGCGGCGGTCACCGTTGCAGCTGGGACGGATGCTGCGCTTGCGTTGAATGTGAATGATTGAGCTGAAACATTAAAAATTGCCACGAAGACGAG
GACAAGCACCACGAATAACTTTGCCATAAGTCTCGCAAGGCGCGCAAAATTAAGAATGGCGTTCGACCGCCTAAACTCGAGCGTATCTGTATTACGTTCT
TTTATCGTGCTGGCATGCGGTGACCGTCTCAACACTTGTAGATTCGCGACCGTCGTGAGCCGCGCGACGCCCGGACATTATTAATCCAACCTTCAGACTT
GTATCGAATCTAGTATTCCGGCGCAACGACGAATCTTGTAGGAAAAACGAGGACAACAGATCACCACAGGGCAATCGACGGGCGCTCTTCCAGTCGTTGG
CGGCCTCTGGTAGAAATCATTGGCATTGGCTAACACATTCGGAGTACATTTCATGGCCAGCTGGTTGACACAAGTGGCACAAAATTGGAGCGAAGAGTGA
GAGGGTCCGCCTTCGTGATTCAGTTGGCTGAGGCGAATGCTTTCTTAGAATCAATCGACGGGACCAGAACCTCCACGTGGGGCTACCAAAAGGATTGGCA
GGCCATAAATGGGCTCGCATATTGAAGGCCAAGCGATTTGCATTGACCCCAAAGATTCGGGTCGAAGTGCCAAACTGTCCGTGTCGATCACGTCAATACA
TGAAGCAGGAGCGAGACGCTTTCGCTTGTGTGAGTGAACTTTACTACTCGTGCTGCGGCCCAAAATGTGCAGCCTTCACCAGGCGCTGTGGGACACTCGT
TTACGATCGAGGCCCCGTTGAAGCACTGCAGTACACGTGCATGTGCTGCTGCAACCTCTCGCGTGCCTGGCTGAGGCGGGTGATAGCCGCGAGAGTCTCG
CCGAGACCGTCTCAAACTCGTCAATCGTTCGTACAATCGACCGCCAAACTCGAATCTACTCAGATACGCATTATCAGTTTAACAGCGCTAATACCTGAAC
TGCTGGCAGCACGGCAAGTTCTGGACCGCCGACTTGTCTCCCTAAACAGCATGAGGTGATCCCGTTGGCATGGTCCCGTTGCCTCTCTACGGTACAGTAC
AACCACCAATATCCCGCCCGATCTGACGCAGGGAACACGACACCGCTGCAGTCCAGCTACAAGGGTAACAACTCCCATCCGGGCCTTCCCTCCACGATTG
TGGTTGCCCAAACAATTTATCGTAGTCGGATTGCGAGGGAAATCACCCAAACATTTGCTTGGACGCGGCAGCTTTTCTCCTCAGCGTTTGCAAAAAATCC
CGACGCGACTGCGCATCGCTGTAGTGCCTAGACACTCCTTCGTCGTGGTGACCTCCACCTTCAACACTGTTTTTTGCCTGATGCACTCCATCTTCCATTG
CTCTAATTTCGCCGCCTTTATCTTCAAACTCGCCCGACTGTTCATACGAAAGCGCATCCATTTCGTGGGCGAGTAGAAATTCACGGATCTTGTCGATCTG
TCCTCGCTCCGGAGCAAAGTTTGAGATCTCCACTTGGCCCGAAAGGTTGGCGATATCAAAAGCACGCTGAAACTTTGTTGACGAGAAAGGTAATGGTAGT
GGCGACTCCACACCAGCACTACATCCACCGGCAGCAGCAACCGGATCTACTACCGTGATCACTGGCACCAGAGCGGTTTTGTGCGGGAAGTAGTTGCAAT
TTTCCGGGATGTCAACCTGCACCCGTATAACTGCAGCTTGGCACCCAGGGCGGTGCAAATCCAACTCCCGCGCCAGATACCCAGAGATTCGCGCTCCTAC
CGCACAGTGTTTCAACGCGACATCCAAAAATTTGTGCCACCGTGAGCTACGAACAGCAAATTAGCAATCGTTAGCGCTCAACTTTCCAAAGTTATCTAGA
CCTTTAGTTGATACAGCAACTCACCGCTGTCGACTGCTTCCCCCACCATTTCCATGCAGATCTCCAGATTCCAGTTCGGGCAGTGGGTAGTCGTCGAAAA
AGACACAGTCAAATTGGTCCAGCGTTGGTAACTGCTGCTGCCACGTACCCGCGACTATTTCCACTCCATTGCGACTAAATGCAAACTGCTGAGCGCGGTG
TAGTGTCTCCCGGTCGCATTCGATGATCGTGTGGCTTTTGGGTCGGAATGTCTGGATGCGAGAGGCCGAATATGCCAAGCCGAAGCCGATTTCCAGCACA
CGATCCGTTGGCTGGATGACGAGCGCGTCCACGCACAGTTCCATGTACTGCATCTCCCACCGCATCATGACCTGCTGCCCCCGAGAGCTCCAGAGGATCT
CCTGCCCGAGCTCATCGAGCCCCTTGACGTTGCCTTGCGTTGTCATTGAATCTGCTAAATATTTGTGATTTATATCGACCAAAAAATAGTCACCTATATT
TATTAGCCACATTACTTTTATTGACAGACATTATTACAATCCTAAAACTTCCTCTCAGCTAACATTAAGCATCACGTTGAGCTGCAACATGCCGCCTTGG
GTAGACCGAGGGACCCAGAGCAATAACGAGCCGCCTCCTGTGCCAGGAAGGCCCAAGAAACCCGGACGCCACCGATCCAGATACAATGTCTTGCCTCCTA
GCGCAGTCACGTTCGACGTCCACGTCACGGTCTCCCCAGCTCCCACGTCCACTTCGTCGACCTTGTCACCACCAGACTTGACGTTCACGGTAACATCTTC
AGTATCGACGCTCTTGAACGTGATGGTTACAGTGCCGTCTCCAACCCTCGTCCACATGCCATCACTGTTGTTGAAGGCATCTTGAACGATCGACATCCCC
AATGCTTTTTTTGCGGTACCGTCGTCAATTTCACCGATGAGCTTCGTGGGGCCACAGATGGGCTGAAAGTACTCTGAAATCGTGCTAGCAACGCCCCACA
AATCCCAAATAGCGTAAAATGACGCTGCCTTGTCCGCAACCTTGAAAGCATAATCCTCGGCCTTCATAAATGTGCCATTGTTGCTCGTTCCGGAACTGAT
GAGATCGTCCACGATGCCTCCAAATGTCTTGCGTAGCGTGTCACGCGTGGCGTAGGCCGCAGCTTCATCCGATTCGGCAAGCAGCTCGTTCATGCAGTTA
TTTGTCACGACGGGGATATCATTGAGCATTAGGTTCGATTGACTCATGGCCACACGAATATCGTCTTCAGAGATGAACGGGTCTTGCCTGCGTAGATCTG
CCACGGTCATCCACGTGCGGTCTAGCAGTCGCTTCATGTCGTATCCGCACGTAGAATTCGATCCCATTGCGGACTTCAGTGATGTAATCTCTGTCTCGTT
CAACGAGCCGATCGATTCGTCGAGTGTGATATTCTTCATGAAAGCTGCGAACGCGTCCCAACTGGAAACGATGGCATCGTCATTAGCCAACACTTCTTTC
AAGGTGTACTCTGCAGTGGTGAGAACTCGGTCCGCAAACTTGACGCTATCGTCGACCTTGATGTCGAGGCACGAGGCGATTGTCACTGGCAAGTCGATGA
TGATATTGTCTGACTGATACAGTACGGCGAGTAGTTTGCCTTGTGAAGTCTGCGGGTCGGAAACCTTGGTCGAGCGGACGTACTTGGCCAACGATTTGAT
TAAGCCCAGCATATTCCTGGCGCACTTGACGGCAACTTGAAGGCCCTTCGCCAGCAATTTGAAGTCCCCGTACAAGCCGAGTGTGGCAAAGGACAGTGCC
GATTGCACCACTACCGATACCTTGGTCACGACTGCGAGCGCACAGTCGTCGTTCTGCCGGATGCATTCAAGGCCGCACTCAAGGGGGTACGAGTACGGGC
ACTGAGCCCAACACGTTCCCAGCTTTCCGCCGAAACCGAGCGGACAGGCTTTGGCGATATGGGCTTCGCGATAGCATGCCGTCGAAGACGAGGTGTCCAG
CGCTGTACCAACCCAGTTCACATATGTAGACTCGATCGTGCTTGTAGCATTGGCAGCACTACCAATAGTGAATGCCGCATATCCTGAAGATAGCGAGGAA
CTCATTTGCGACCGAGACGCACTCACTGCCTGAGACGAGCTGTCGTCGCTGTCTGAAAAATCACCGTCGGTGCTGTCGGAAGAATCGTC