Description :
From Genome Similarity Track
Location :
Scaffold_32:1227883- 1229100
Sequence
1217 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGT
TCGTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAG
CCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTTGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCT
CCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCAATACGACTGAAGGCTAAGCCGTATGAAGGGAAGGAAGGCGAGAGCCTTCACTTCTGGGTCCGAGA
AGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACGGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTAC
ACTCGGGATGCAACATCCCCTGGATGTTTCACATCCTGGGCTTAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGC
GTTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCTACTCAA
CGAACACATCAACATGACTGTGCTCATGGATGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAACACCCTTGAAGAGGCGATT
CAAGTGGCTCTTCAAGAAGAGTACAGCCATAGCCAGGCCCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGTCGAACAAGTCCCA
ACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGTGACTGCCCCGCGGA
AAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAAAAGCCAAGATCCCGGGGACAGGGGAACGCAGGGAACCAGGGGCGCCCT
ACTGGGGAAGAACTAAGTCTTCATGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCATACTCGAATCGGCGAAGAACA
GCGGCGGGCTGCTCGTA