Description :
From Genome Similarity Track
Location :
Scaffold_1:122759- 124188
Transcript NameFunction/comments
Phypl_g43hypothetical protein PHYSODRAFT_475141

Sequence
1429 bases(100 bases per row)
TGCTGGGTAGCGTTTGCACGGGGAGCAAGCCCCTAGAGCGGCGGAAATCCACCGCTCCACtctctgcgtcgtcgtctacGCCTTACAATCAGGAGATCTG
GCCTTGGTTTCAGGCTGAGCATGGCGATGCACGTTGAAATGCTTTCGCTGCTTGGCAAAACGCACAGCACATCGTGTTCTCTTCCACGAAGGAGAAAGTA
TTCACTTTATGGTTTTAGGTACTTTAGGTAGTCTTTACTTACGGTAACGAAGATGGTCGGTCTCGCTTTTTTAGATGTTGGCCCGGGTCACGAGTGAGGG
CGCCCGTCGCACGTCCGGCTGCCAGGCGCTCCGCAtcgtcgccgagctcgcGAGTCCTTCTCCCGATCGCGCCACTGCGGTGGCAatcggcggcagcagc
acggacagcGCCGAAGGGACGGGGGCAAGCTCCGCCTTCGGCGGGGTCAGCGAGTTGCGGTGCACCCACGCGTGCGGGTCCGCGGCGGGCTCCATCTTGA
CCATCGCCGCCACGCGGAGCATGGCTCGAGGGCTCCTCGGGTACGACACGTTCATCCACGTGGCGGGCGGCAGGCGGCTCGCCTCGTGCCACGAGTCCAC
CTCGCTGCAGTAGGCGGGCGCGCTGCCCATGGCCACGAgtcctgctgcgcgctgcagctccaggaggGACggggcggcgcgcggcgtgcGGATGTACTGC
GTGGTCAGGGGCACGGCGCccagctgctcctcgagcttgagctggagcgagGCGCGCATGTGCATGCGGCGCGCCAGGTCCGAGAAGCCGCTGGCGCCCG
CGTGCAGCGGCAGGTGGTTGGGCAGGCCGAGGGCCTGGccggccttgcgcttcttgtccaggcggcgctggttgCTGTTGGCCTTCTGGCGGTGCATCTC
GCACAGGTTGTGGCGCTCGCCGTTGCGCTTGATGGCGCGCAggttccagcagcgcttgcTGGCGTAGCGGCACTTGAGTGAGctgaactcgtcgtccgtg
gtcTGCTGCATGGTGGCTCGGTCCATCGGGGGTGGAGGGGAGGAGGTTGGTCGTCCGGAAGGTGACAAATTGAAGAGTGAACCGTTGGAGGTGGAACGGC
GTCTTCAAGGTGCAGAATCTTAGCCCGTCGTCTGAGACGTCGACTTACGGGCGGCGTAGCGACTTACCAGATGCTTCAGCATTTTTCAATCCATACAAAG
AGAAAGGCAATCGTCGACTTTGGGGGTGAGGAGACGCCGAGCACGTTGACTTAGCGGGAGGAATGTCGCTTTTTGGTGTGAGGCCGTTTGGAGAGGAGAC
GTTGCCGCTGATTTATGGTCGGAGTATGCTGTGCGGGCCACTGCTTGCAAGCTGCTCCGGACAGATGCAAGGCGGCGAGGAAGCTTTCGCTGCCGGATCG
TCATCGGTCTGCGATATGTGGCGCTGATT