Description :
From Genome Similarity Track
Location :
scaffold_4:122741- 135801
Transcript NameFunction/comments
Pl_112918hypothetical protein PHYSODRAFT_350602
Pl_112919hypothetical protein PHYSODRAFT_354328
Pl_112920hypothetical protein PHYSODRAFT_354328
Pl_112921hypothetical protein PHYSODRAFT_259509

Sequence
13060 bases(100 bases per row)
GTCCACAAAACGTAGCAGTCACTTCCAGTGTGCCAGAACCCAATCAGATGGCATCACCTTCGCCTCCACGGCTGCTGGTGCTCTACGGCAGCGAGACCGG
CACGGCGCAGGACGTGGCCGAGTTCGTCCAACAACGCGCCTTTAACCGGCAGCTGCTGGACACGCAGGTTATGGCTATGGACGCGTTCCCCGTGGTGCAT
TTACCGCAGTGCTCCACTGTCGTCTTCGTGGTGTCCACTACTGGCGACGGTGAAGCGCCCGAGAACATGCGCAATAGTTGGCGCAGTCTGTTGCGCAAGA
CGCTGGGGCTGCAGTGGCTGACAGGTGTTCGCGTTGCTGTCTTCGGGTTGGGCGATTCCAGTTACGCCAAGTACAATGCGGTGGCTAGACGGCTACAGGC
GCGTCTCCTGCAGCTCGGGGCTTCAGAACTGATCGACAGAGGACTGGGAGACGATCAGCATGCTTACGGATACTTTGGGGCATTGAATCCTTGGCTGGAA
AAGCTCTGGACGGCGGTTTTGCAGCTCCATCCAATGCCGGAAGATGTGACAATTGATGACTCTCCGAAGTCAATCGAACCTCGCTACTCGATCGTTTTGC
GTGAGACTGGAGATAAAGAGGTACACGAAGCAAATGTGTTGACGCCAAGAACAGATGTATCCAACTTTTACACGCCACCACGCACGACGGTAGGAAAGGA
AAAGGGCATTTACTTGGCCCCGGTTGTGGTGAACAAACGAATTACGGCTGAGGACTGGGAGCAGGATGTGAGGCACTTGGAATTTGATATCAGTGATGGT
CTGAGTACTGAGGACGCTCCGTTCAGAGCTGGAGATATTGCAGTAGTCTACCCAGAGAATGCGACGGGTGTGGACGATATGCTCAAATATGTGAAACTGG
ATGGAGAGACCGTCATCTCGATCAATGCTGCTGATGGCTCAAAACAGTTTGACTTGCCTTCTCCGGTCACTGTGCGTGATGTGTTTACAAAATATCTGGC
GATTCTGGAAATCCCGCGTCGAAGCTTCTTCGAGAGATTATCATTGTTCGCAACAGATGAGGAGGAGGTAAGGATTCGAGCACACTGAAATTCTTACACG
CTGAAATGCTAACGTGGTGCATGTTACAATTGGCTTTGCAGAAAGAGAAGCTTGAGGAGCTAGCCTCGGCTGAGGGTGTAGATCTGCTGTACGACTACTG
CATCCGTGAGAAGAAGACGTACGTCGAAGTTTTGACGGACTTCCCAAGCGTGACAGTGTCTTTGACGATCTTGCTGCAGCTGATTCCGCGTCAACAGCCC
CGATCATACTCCATCTCTTCATCAGCCATGCTTCACCCTGGTCGCGTAAGTTGTGATGCAGCTAACTTGTTAATGTCTGGTTTGGAAGGTGAGTCTAATC
TATAGGTCTTGTTTCACGTGTTGATAGGTGCATTTGACGGTGGCTATCGTGGACTTCTTGACACCGTATAAGCGTCGTCGTTATGGCATTTGCTCATCGT
TCTTTCAGTCCTTGGATCCGTCCAAGGAACAAAAGCGCGTTTCAATGTGGATTAAGAAGGGTCTATTTGAGCCGCCCAGCTTAGATCGCGACGTGCTGCT
TATCGGCCCGGGAACCGGCCTTGCCAGCATGCGAGCGATGGTGCAAGAACGTCAATTCCTGCGCAAACAAGCAGGTGGAAACGATGCAGGAACAACCTAC
CTCTACTTTGGATGTCGCCACGAAAGCAAGGTGCGGTGCTACTTGATCACTACATTAAATTTCGCACTTTATCTTATGATCACTTGTTGTGCAGGACTTC
CTCTACGGTGACGAGCTGCGCAGACTCGTAGCTACGGGCGATCTCACAGCACTACACACTGCATTCTCACGAGACCAGGTACACATTCCAACGCTTAATA
GCTTGTTGCATTATGTTGACTTTGTGGAATCGTGCAGGACCACAAAATCTACGTGCAAACACGTCTAGCAGAGAACAAGGAGGCCGTGTTCGACTTCATC
ATGAACGGTGAAGGATGCATCTACATCGCCGGCTCAGCGAAGCGAATGCCCAACGACGTCTACGAGGTGTTGCGCGACATCTTACGCTCCGTAGGAAAAA
TCCCCCTACCAACCGCCGAAAAGGTGATGAAGACACTAGCTCGTAAGAAACGCTACGTTGTGGAGTCATGGTCGTAAGCATTTGCACTAGAGACGAATAC
AGCTCCTAGACCACAGTCTCCGTTATCCCATTTTCATTCGTTAAAACCCTGCAAATCATGGACGCGAAGGAGTTGGAACAGGAACAGAATGTGCGCATGT
TCGTGAAGCTCGCGAACCTCACGCAGACGTCGCAATTGCACGAGTGGAACCTCGAGTCTCTCCATAGAGCTCTACAATGGGCCTGTGCAGCTGAAGATGC
AGTGAGTGGGGACTCGCAGGACATTGAGATGCGCATTCGTCGGTGGTTCCCAGTTGCCACACTGCCCACGCTGCCTTTAGATGGAGCTTTGACGGCAGAT
GCACTCCGTCATGCAAGATTTCATTTGCTGCGATCAATACTGCAAAGTCCGTTCTTGGCATCGCATCCGACACGATCGGAACTATTGGTTGTGGTGCTTC
AGGAGCTCCAAGACAGACGAGGGGATTCGTCCTATCCATCAATTGATGAACTGGAAGAGCATTCGCCCAACAGGTAACTGCAGTTGGAATGACGAAGCTG
TAGAGAACTTATTGTGGTTGTTGGTTTGTTAGTTCCTTGCTTACTGAAAAGGTTACCGGAGCTCCACGTATGGATGCTATGTTGGCTATTGCTCGTCGTA
TGAGCGTCACGTGTAAGCGTATTCGGGTACAAGGTGAGTTGGTTGCTTACTCTTAAGGTTGCGGCCATGGCTGACTTGATATGTTAAGTGCTTTCAGGGT
GGGTGTTGGTGCCTCCACTCCAGAGTTTTGCGCTTTCGCCGCGCACGCTTCAACTGAAGGCCATGGCGAAAACGTTGCAGCGGAATGCAGTGGATGCTCG
TGCAGCAGTGAATCCTGAAACGTACCATGGTTTCTTGACTGATCTGCGAGGCTGCTTTGAAGCATCTGAGAGTAAAGATGCCCGGGTAAGTGTGTTGGGT
AGTGGCGTGTTTGATACATACATGTCTGTTGATGAATAACGCCAATTACAGGAAGTTGTCGTGTTGATGCTTGTCATGTGCGAATGGCCCAAAGTGGAGC
CTCCACAGCTACGGGGAATGATGGAGGACCTCGTGAGCATTGTGATTGACTGGTTAGCGCGTAAGCCCATTCGATTCTGGACGCTTCAGCCTTGGCTAGC
TGCTATGCTTGCGAGTAAATTCGATGCTCTTATGACCGTCTACATTTCCGAGTTGTTCAAGACAGGACTTCTACAACCATGTACGATAATGCGTGTCACA
ACCGTGTGATTGACCACCTTTTGACTTCTTGCTTTGCTCCAGGGGATCGAGAGTTTTCAGAGCGCGTAGCAACGTTGGTAATCCAAACTGAAGACGTGGA
AGCCGTATTAAAGCCGGCTCTGATAAAGCTGGACCCTCATTTGCAGCAAGTTTACTTCAACATCATCACGCGCCAAGACTAAGTGTGCTGAATGGTATTG
ATCTCATTTGGCGTGCCGACACAGCACGTCGACAACTTCGTGATGTCCATTCCGCAGGGCTAGATCTGTTGCAGTGGGGTGAGGCACTTCCGGAAGTGGT
AGCGTCGTATCGACGTCACCTGCATCGGTCAGTGCAGCGCAGCACTCAGCGAACCCTTCTTCTCCTGCGATAAGCAGAGCGGTATATCCAAACCGATTGC
GTTGATTAACCAGCGATCGAGTCCATTCTTCATCGAGGTGTGAGGATTGATGAAGATGGTGTAGTATCAATTGCAACGAGGTTAGTGCATTAGATGCTGT
TGCAAGATGCAAAGCTGAATTTCCGTCGGCGTCCAACACGAGTACACCTGCTCCATTGCTAGTGTTTCACAACAACACATTGACCGCTGAGTTGGCAAAA
CCTAGCGTCGGATCGAGTTTAGGCGTACCGAAGAAGAAAACTGACGACGTCGTTGGCATCCCAAGCCGATGCATGCTGCAGAGCTGTGCGACCAGTGTGA
GGGTGTCGTGCATCCAGCAGAGTTGCATCATCGGTGTACAACGTGGTGATAGTATCTACGTTGTTGTCTGCTGCGGCTTGCATCCATCTATCTAACAAGT
CCATCGAGTTCATAACGAGTCGGCGCAGCACAAATAATGCTCACACTATTAGTTTAGATTGTACCTGTGTGATGGTTATAGACACTAGGAACCGCAACAA
CGACATATCAATCTGTTGTAAATCCATACACCTCGGTCTCCAACATCGCGTACAGCACGGCTTTCAATTCATCACGCACAACGTGGAGTGGCAGGTCCAG
GCGGTTGAAACATGCATGGCTGTGAATGAACCCGTCGCCTACAAGTGACACTGCCTTCAGTGTAAACGGGCACAAGTGACCATCGTAGCTCGTCAGTGCA
CTAAAACCGCCCAAGGGTACGCGTGATGATCCTGTTGAGAATTGTAGCAATCGGCGACGATATTCATTCGGCATCTCACGCACCAACTCCCAGAACCAAA
TCAGCGCACGGTGATGATGAAGGTCTTCTGAGTACTTTGTGTTGCGTTCCCAGTCGTCCACGTCAATTTCGTCCGAACCGCACAACAAGAAGTCGAACTC
TTCCGGGTCGAAAAGCAACAGCAATTCACGCGGGACGACTTCGTACAATCCACGGAGTAAGGCTTGTAATTGCGGCGTCACACTATTCACCAGTAGGTAC
TGCCACTTACACTCCACATACTCACACTTGTTTTTATCGGAGACGACGATTGCACTTCCTCCAGGAATGAGTTCGATATCACGGTATTTATCTCCGTCTT
TGACAGTCACTGTGAAGTTCAATCCAAGCGACTCGACATTGTCATTGTCTAACAACCAATGTAGATTCGTGTACACTTCAGGGTCCAGGTCTTCCAAGTC
TGCAAAATTGAGCGGATAGCCTAGCATCATCTTTAGTAGAGGCGGTGCTAGATGGAAACACAGCATTGAACCTTCGAGCAGTGCACGACCTAAGAGTCGA
CCAGATGCATACAGATGCAGTAGTTGGTTAGGCAAGAAATCCGCGAATGAGCACGAATTCAAAAAGTAGGTCTGCTCGCTCTTGTTGGTGCATATGAACA
GCCCTCGCGCAGGGTCCACAAGCATTTCATTCAGCAGCACAAACCATTCACGATGCAGACCACCAGCGTCGACACCGCTTTCATCCAAGAAATTAATGCG
CATTACAGAATGTACGTTCTGGAGTGGGATAATTGCCAAAGACTCCATCGAGTCTTCAAACACGTTAGCACGTTCTACATTGAGTCGCAAGTGCTCCTTT
TCAGCAGGAACCATAAGCGTCGATGTCGCAGTGACAAAGTGAGCGTATTTTGACGGAAAATCCTTGCTCGCAAGTGCCATGGTCTCGGTTAAAGAAATTG
ACGATTCTTTCATACTGTTGTTGGGACCAACCCCAATATGCAGGGGCAACTTCGACGAATCCACAGCTTCATCAGAAGCAGCAGTTAGCACAACACGATG
AGTCTGAACTCTCCGTACCAAGTTTGCAATGCATTCTTCAACAGAACCAACCACCGGTTGGTGAGTGCTAGCGTTTCTTGAATTCTCTCCAGCGGAATGT
TCCTGCTCTGGGTCAGGTTCGAGGATACCCGAACGTACAGAAACCTCATCCCCATTAACCAATGCACCAGTTCCATATTCTGGTATGGATGATCTTGAAT
GGACAACCTCGTTAATTACATCAGTCGATTGCATTTCCGATACAGATTTTTCACTCTCAGTTGACGTTGCGTTTTCCTCTATCAACGACAACGTCGTATC
TGTGTCAGATTTCGTATTCGTCGACTGAAATCTCACAACGAATCCAGATAATTGCGTGTCACCCCGTCGACCGTCTCTGAACCAATACGCACGACCTTCC
ACGTCCACTTTCCTCGTCCACTCCTTGCGTCGCTGCGCGCGTAAACGACGTCGAGTCGTTTGTTTCGGAGGCGTTTTCGTGACCAATTCGACTCGTTTCT
CTCTCTTAAATAGCGGTAAAAATGACAGTCGTGTCGCCTTTTTCTCTGGAGTATCGCCACTTCCGTCTTGTGCGTCGATGACGAGCTCGTCTCCACAGAC
TGTGCAGAATTTGAACCGCTTGAAATTCTCGAAGCTGCAGTTCGAGCACACATTGAAACCTTCTTCTGCATCTCTTAGAGCTGCGTCCAGGCGACGGTCT
TCTGAGCTGTAACAAAGATAAAGTACGTTGTTAGTCAGGTGGAGAAGTGAATGGAATTCTGTGACGCACTTGAGCAGCGGCGCGTGTAGCTCCAGAGATC
GTTGACGACGGATATACGCGCGTCTGGCCAGCATGGAAAGGAAGAAGAAGAGCAACGCGACGATGGCCAACACCGCGAGGAACCCCACGACGGCCTGCAT
GGCGCCTGCGGTATTCGAATCTGGGTATATTGCGTCCGTCCAGCAGATTTCGTCATCCCATGTATGATGCACAAAACTGTTTACCATGGGTACAGATTAC
TTACATTAAATAAGATGTTCACAGAGGAGCGTAAACTTTTGTGGAGAGTAGTGGCGGTGCTGATGATGAGTGTTCGGACTGTACACTTTGTTGATGCGGG
TCGCATGATTACTCGATGATTGATCTTGCCAGTCGAAGCTGTTCACTGCCATCAACACTTATTACAAGAAATACTTTAATTTTAGGACGCAACTTACTTA
CAAATTCAACGAAGCTCTGTCATTCCGTCGTGAAGCCGTATACTTCAGTCTCTAGTATCGCATACAGCACGGCCTTCAATTCCTCTCGTACAACGTGCAG
AGGCAAATCTAGACGATTAAAGCAAGCGTGACTGTGAATGAAGCCGTCACCTTTCAGTGGCACTGCCTTCAATGTGAATGGACACAAGCGACCGTCGTAA
CTCGTGAGAGCGCTAAAACCACCTAGTGGCACGCGTGATGACCCTGTCGAAAACTGCAACATTCGACGCCGATATTCATTGGGCATTTCCCGCACCAATT
CCCAGAACCACTTGCGAACTCGGTGATGGCGCAGCCCTTCTGAATGCTTGGTATTGCGCTCCCAATCGTCCACGTCGATCTCTTCCGAGCCACAGAGCAA
AAAGTCGAACTCCTGCGGGTCAAATAGGACCAACAGGTCACGGGGAATAACCTCGTACAAACCTCGTAGGAAGACTTGCAATTGTGGCGCCACACTCTCC
ACTAATAAATATTGCCACATGCGTTCCACGTACTCACGTTTGTTGCTGTCAGTAACGGCGATTTCGTTTCCGCCAGGTATAAGCTCAACAGTGCAGTAGC
TCTCCTTATTCTTAGTAGTCAACGTGAAATCGAGTCCGAGCGCATCCACATTGTCGTTTTCCAATAGCCAACGAAGGTTTGTATAGACTTCAGGATCCAA
GTCCTCTAGATCCGCAAAACTTAATGGGTAACCTAACATCAGCTTCAACAGAGGTTGTGCCAAGTGAAAGCACAGCATCGATCCTTCCAGCAACGCCCGG
CCGAGTAGACGACCGGCTGCTAAAAGATTGAGCAGCTGACGAGGAAGAGCATCCGCATCTGAACATGGACTTAAAAAGTAGGCCTGCTCGGCCTTGTTGG
TACATACGAAGAGCCCGTGAGCTGGATCCACCAGTGCCTCGTTTAGCATCACAAACCATTCACGCTGAAGTGCTCCGGCGTCGATACCGCTCTCTTCAAT
GAAGTTAATACGCACCACAGAATGCAAATTCCGAAGCGGAATTACAGCGAGAGATTCCATCGAGTCCTCAAACACGTTGACCCGCTTTACATTCAGCCGC
AGATGCTCCCTCTCGGCAGGAACCAGAAAACTTGAGGCAGTTTTGACAAAGTGTGCATACTTGTAAGGAAAATCTCTGCTGGCAAGTGCCATCAACTCGG
CCGTGGGTGTCGATTCTGTTCCATTGTCCGGGACGTTATCTGGAGCTGGGGTAGATCCGATTGGACCGATCGAGACACTGAGCGAGAGCCTTGAGGCATC
GACGCGAGTATCCGACACTGGTATGAGCACCGATTGCAGCTCCTGTACATCGTTCTTTAAAATTGTCATGCACCTTTCAACTGACCAGAATGTAGATCGT
GGTGTTGGGGGGATCCTGTTCCCCACATTGTGCTCTGGGTCCGGTTCAGGGACACTGGGGCTACTTGGAGTAGTTAATAGTGGATTTGACGAAGACGCTG
GAAGTGACATCGAGGGTTTTGTTCGTTCTTGATCTTCTGACTGAGCAGGAAAGAGTTCTTCAGACGCAAGCTTTGGTTGTTGAAATTCATCAGACTTCTC
AACCACGTCCGGTTCACTGCTTACAGGTTCAAACGCAACAACAAATGCCACAGGAAGCATGTCAGCCTTAAAGCGACTGTCACGAAACCAGTACACGCGT
CCTTCGACATCCACTTTTCGTGTCCATTCCTTGCGTCTTTGCGCCCGCAAGCGGCTGCGAGTGCCTTGGTTAAAAGGTTTCGTCACGGGCGTCGCCGAAG
GTAACTGCACGTGACTCTTTCGTCTAAATATCGACGAGATTGTCCACTTCTTTGCTTTCTTCGTACCATCCTCTCGCTGTTGGTCATCATCCTTCTCCAC
AATCGGTTCTCCACAAATTGTGCAGAAGCGAAATCGTTTGAAGTTCTCAAATTCACACACTGCACACACATTGTATCCCTCCTGTGCGTCTCTTCACATC
TCAAACACAAGTCACATTGTCAGCTCTGTTCTCCTCACCCTTCACTTAAAACGGAGACCAACCTCAGCGCTGCATCCAAGCGTCGATCTTCCGAGCTGCA
AGACCGTTGTAGTCACACAGAATAACCATTAGACATTAAGTAAAATTGGGCAAATAACAAAGTCATTGTTGCCAAACGCACTCGATGAGTGGCGCATTGA
GCTCTGCTTCGCGCTCGAAATTCTTGAACGACCGTCGAGCCAGATACCCAAAGCACAGCGCGAGGAATAGTGCGAGTGCACACGCCATGGCGATGGTCCC
GCCCACAGACATCACTCACTCGTTTTCTTGTGATTCTTGAGAAGGGCGAGATGGAGAGTGTCACGGGAGCCATCGTGAGGCGCATTCTGGTTCTCAACTC
GAGCTGCTGGTCTGCAGACCAGGTGTGGTAAAGCTACCATGACGCATAGAAATCTTTACCTCTAGGGCGAAGTAGCTAGAAAATGTATGGAAAAGATATG
TGTACACTTTGTTATGAGGCTTTCGGGTGCAAAAGTGAGTCATGTTCACGAATCAAAGTTTTCTGACCTCAGTTGACTCAACCACGACAAAGCTGATGCC
GAAGCTCGAAAGCTCATGAAATGCCACAAATACTCAAATATTATTGCAGCAATTGTAGCTGCTTACAATAGGTTTGCTCAAGCCGCATCAACGGTTCGTA
TGAACACGATTGGCGTCCCATGACGCCGATCAAGGGTTATGCCGTCGTGAAACCCGTGAGATCTGTCTCCAGCGTGGCGTACAGCATGGTCTTCAACTCC
TTCTTACTGTGATACAGCGGCAGATCTAGGCGGTTGAAGCACGCGTGGCTCGAAATGTACTGCGTCATTTTGTACGACACCCCCTTAAGATTGAATGGAC
ACAGGCGGCCATCGTAGCTCGTGAGGCCACGGAAACCCGATAGCGGGACGCAGGCTGATCCCGTTGCGAATAACAGTAGACGCCGACGGTACTCATTCGG
CATATCACGAACAATCTCCCAGAACCAATTCGTCACGCTAGCACCCTCGAGATTAGGAGACATAACGGTGTGTGTTTCCCAGTCCGTAACATCGATTTCA
GGGGACCCACAGAGCAGGTAGTCAAACTCTTCCGGATCGAACGCCAGCAACATCTCGCGAGGAATTACTTCATAGAGACCCGTCAGGAACGCGTACATCT
GATCCGCCACACTCTCGAAGAGTACATATCGGAATCGACGGTCCAAGTACTCGCGTTTGTTGGCGTCTGTGACGGCCACATTCCGGCCATTCGGGATCAA
GTCCACCACTACCATCTCGGATTCATGTACCTGCTCGGTTAGGCTAAAGTCGAGTCCAAGATCATCGACGCCATCGTTGTCCATCAGCCATCGCAAACTG
CGATAAGTCTCCGGATCAAGGAACTCCATGTCGGCGAAAGTCACTGGCACACCCAAGATCACCTTTAGCAACGGCAGCGCGAGGTGGAAACCCCAGATAC
CACCTTCCAGCAGCGCACGACCAATTAAACGCCCAGTGGCGAAGTAATAAGCAAGGTGGTCTTCGCCCACCTCGGCGCGAGACTGCGGGTTAAGAAAGTA
GCTCTGATCGGCTTTGTTCGTGCAAGTAAAGAGGCGAAGCGTCGGTGATGCCAGCAGCTCATTCACCAGCATAAACCATTCGCGGTGCACACCACCAGCA
TCCACTCCACTTTCATCCAAAAAGTTGATACGCATAAATGATCGCAGGTTCTTCGGCTGGATGCAGTACATGTGGTCCAAAGACTCTTCCAGCATGTAAT
CTCGATGCACTGACAACTTCAGAAACTCAACTTCCGCAGGCACAATGAGCGAAGCAGTGCTCACCACAAAGTGAGCATACTTGGATGGAAAGTCGCTATC
TGCCATGGACACCGCTTCCTTCCGTCGCTCAGGACCATCATCAGCAAGAGTTGATTTGCCTGTCGGGAATTCCGCAGGATTTGACGCCGACGCCTCCACC
AACTCCAGCTTCACGTCCGTCGGTAGGATTGGGGTTTCCATCTCATTTTCCTTGGTCTCTTGTGGTTGCTCGACAGTGACCACTGGTTCAAGTTCGGTCG
TCTCTTCCTGATGTTCATCCACCTGATCGCCATTTGCCTCCTCTTCTGGCTCCTTTTCCTCTGAGAACGTGAACATGACCGTATATCCTGGCATGAGTGT
GTCCATCTCGCTACTCACTGGCAAGTTGCTGCCTCCACTGCGATACCAAAAGAGGTTTCCTTCCACATCCAACTTCCTGCTCCACTCTCGACGGTTCCTA
GCACGGCGCTGCTGTCGACTTAACGACGACATTTTCCTCGGTCGTGGCGACATTAATTGGATCGATGGAGTCGTTTCCAGCGATAAATTCACAGTTCCAG
CAGTTCCTCTGCTGGAATTCTTCTTCAACTGACGTTCCTCCTCCTCGTCGCTCTCATCGGCCGTCACCATGGACATGGACGGCAGCTTATCGCCACACAA
GACGCAGTACTGGAAGCGCTTGAAGTTCTCGAACTCACAACTGGCACAAACACTATAACCAGCTTCAGCTTCTCGTGTGGCGGCGTCTATTCGGTGGTCG
ACCGACTCGCCTGAAAGCAGCGGCACTTCCATATCGAGGAGGTGGCGATTACGTCGACATGCCATGAGCCACACCACGAAGAAGATGATGCACAGCAGCA
GCATCCCCAGGCCTTGGTACAGCATCGACGCTTCCGTCGTGCGATCATCGTTGTCCATGGTCGTGTCCAGGAGCTTGTGCGCTTCGGCGGAATACTGCAA
GTCAGTCACACACTGGGAATGACCTTCACGATCACCGTTACACAAGGGATCTCCACCACTTGGTTTCAGTATGGAGGAGCGCCCCGACTCTGCGCCAGAT
TCACACAGATGGGGATTACGCCTTCAGTTAATACCTCGAGAGAGTGACAATCCAGTCGAGGGCTGTATTGGATTTGAATATGTCAGTAAAGTGGAGGATG
AACAACCTCTTGAAGTGACATGTTGACGACATCTGCAAGTTGCAGGTGTTGCAGTTTTAACGTTAGTGCTGCTTTCCTTCAGATCTGACGTCGTCTGGGC
GGTTGCTGGCAACATGTGCAATGTCGAATGCCGATCCGAGCGCGAACCGTATGCCGATTTCCGCTGCGAGGTCGGACATGCACTTGCCCTTGTTTACTCT
TGTGAGAATGGTTACACCCGCGAGAGAGTCTTGCAAGATGACGGCAGCTTTGAGAGCGAGTAGTTTACGAACGAGTGTGAAAACGAGGCTTTCCTTTCGT
GAAAACTTCGATTGAGAGACTTTCCACAGTTGTTGCTTACAACTGCCTCCGAGATTGACATTAACTGTAAAATTTCTACAAGCAGTGTAACAGTACATCT
TGAATGAATTTATTATGCACTGTGTAGGTAATGCATATGCTGCTGCACTGCTGAATCAAAGCCACTTTAACGCTTCGCCATCGAAAGATGCCGCACTTCA
GTAGTAAACAGCCGCTATCAAAAGGATTGTCCGCAGAATTGACTTCCTACGTCTGCCCACTAGCCACATGTGCACGAGCATTTGTTCTATTACAAGATGA
TGCCAAAGAATGCCTGGAATCTTCGTTTACTTCATACATCTTGAAGCCGTGAATCGATTACTACTCTGTCGTGAATCCATACTTCGTGCCGCAAGCTGTG
CGCAACACTACCTTCGGAAGCCACCATCGGTACTCGCGATCACCCCTAGCAAACTGTAGCAAACGACGACGACATTCTGGATGCATACCTCACACTCTTG
CCTCAACGGATTTTTGGATCACTTATATGGGTTTCCAATCCGTCACATCAATGAAGTCTCAGCCACGTAGTGTGTAATCAAAGTCTTTCGCGTCAAGCCT
CAGAATCACTTGGTACAGGTTTCAAAACCACGTACTGCTGACTTAAAACGCTCTCCAACACAACAAAATGAAGTCAGTGCTCTGTGAACCTATGTATCTC
CTCGTAGTCGCGATACATGATCGAAAAAAAACCAAGAATAATATTCAATGAAGGTATGAAGTGCAAGTAGAGAACGAGCTACGAACACCAAAGTAGTACA
CAAATTGCAGTTCCTGAAAAACTCACCTTGAAAACACACATCTGTCTCGTGGTTGGCACAAGTAAATAATGTCGGATCAACAACCAGGTTCGTGACGAGA
ATGAACCATTCACGATGCATGACACAGCATCCACACCACTATCACCTGCGAAGTTACTTC