Description :
From Genome Similarity Track
Location :
Scaffold_23:12272- 15568
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.54Conserved gene of unknown function

Sequence
3296 bases(100 bases per row)
CCACAAAGATACTCTCTTCTTTCTCTTCTTCACCACTGACGATGCGATTGGTTTGGCTGCTCGAGAAATGTTGTCGAGGCTCTCGTAGCAATGGAATTTG
TAAGAATTCCGGTGCTCTCAGATCGCGTTCATGAACGAAGATAACGCCAAAaTTGAGCTCCTtCTCGCTTGCCACCGAAGTTGAaaCGCTGCCTGAAGGA
GCGTTAGCAGGgCACTCGATGCATAGAAACTGGATGATTCTGCTTGGGCCATACTCGAGCTTCATGTCCTCCTGAATTGCCGCTTTGGTAATTGTGGCGA
TAGAGTATGCTTCACCTAGAGCTTCTAGAGATGAGTATACACGAACCCGTGTCTGCGCTAGGAATTGAGCGACTTCGTCTGATACTATGCAGCTCTTGTG
TGAGTTCGTTGGTGATGCGACGTTCTGCTTCAATTTCTTCGTCTCGTCATGTCGGTCCTCGTCGCCATCGCTCTCTTCCTCTTCATCGCTGTCGTCCGGA
GCATACGCGAGTGGATTCTTGCGCATCAGACTGGGGAAGCAAGCCTTGACATCGTGCAAGAAATGCACAGCACACTCGCCAACCTCCAGGATCTGCGCGA
CACACACCGTCGATCAGCACGGAGCGTCAGTCGAAGTGCAGTGCGCAAGTCTACTCGGACCTTTACTCTACCTGAATCGCAGGCGCGCTAGCGTTGCTTC
GTGACGGCGCCAGCAAGGGCAGCAAGAGGAGAGTGCGCCGAGCTGCGCGCTTGATTCGTCCACCGATGCACGTCAGCTGACGCGTTGGCTGCGAGCGGCA
GCAGCCTGTGATCACTGCGTAATCCTCTACAGGCAGCGACGCCTTACTATCTGCGCGCAGCAACTGCCACTGCGACACCGAAGCGCCGTCATCCGCCGGA
TCATCCGCCAATGCAAGCATGTTGACGCTTTGGGATCTGATCAAGATGCATTACCCATCATCGGAAACGTTAGAAACCGATAGAGTAACCGGTTTCAAAG
CGGCTTCTACAGCTCGCCTCGACGCACATCAAGGAGGGTCTAAGTAGTACCTCCGTTCGGTTTTtAATGGATACCGACCCTTTGGAACATGGCACATTAG
AAAGGAAAGCAATCTACGCAACCACTAGCTACAGAGTACAAGTAGTACTCTGAATGTTTTGGTACGGGCTTTCGTCAGGCAGAAATCTCAATATGTCGTC
AACGACTGCCATGCCTCCAGCAGGAGAATTCACAAGGCAGCCTCCTACAAAAGGGTAGGTGAAAAGTTTTtAATCATCCGAAAGCCTTGGATACTATGCA
AGTCTACTCTACACAACTTGGTCGCCTCTTACAGACCAAGAGCTTCTATCGACCCGATGCAGGATGAATCTGGAATGAGCTTGAGCGGAGTATCACAATT
CCCATGAGCTCTTCTCCACcACCCAATTGTTTTTtGTCATACCAGGTCATGGTTTGTCCTGATTTACCAAAGCAAGGTGTAACCTGATTTTCCACGAGTA
ACCCTTGGTCTGTTCCAGACGCATCACAACGTGACGTTAGAGGCGCATCCCGCGTTTCTGCCCGTAATCGTCCACTTGAGTCtCTTTTGCGTGATCCGAT
TGGGCCATTGTCCCCGTATTGCAACCAGGGCATGGGTTCATTCCATCAGGATCCCTAATCCTCATGAACCTACCCAATCGCTGCACCCATTGGCACATCA
GGGCTAGGTTGTCCCTATCCAACGGCGCCGGCAATCACTTTGTGCAGGGAACGCGCCACTGAGAGTCAGCAACACAACATGGGCTGGACGCCCTCGTTAT
TGATTGCGCCTGAAGGCTGCGACGTTAATAAAAGCAGGCGGCGCCATCTCGACGTGGTCCAGCCTCAGACAGGCATTCCTCCGGCGTCAAGCGTCGCCGT
CTACCTAAAGCGCGCCGTTACTGCGCGACGACACACTGGTAGTGAGCTCGGTGGTGCTGGGTGGAAGAGAACGCGAGCGGAACGCCAGCGGAAGAGGAAG
CCGGCGGTCTCACCAGCGTCGGCGTTCGATCCATAtcACCGGAGCTTCTTCCCGCCGCTCTCCAACACCACACGCGGTGGTGTCGCGCCCAGTCGTCTCT
ACCGCCAATTAGCTCTTGCATGGTATGCGCCGTAGCCGCGAGTCATTCGGGAACCGCTCGGATCAGACCAGCCTCAGCCTCACGCCATCGCCGCCCTCTG
CAATCTCCATCTtAGGGGgagACGCCCcGTACACAGTGCCTGGGAGCGTCGAATCCATCCCCGAGCTGTCGCCCGTGACACCGCAAGAAGgTCCATCGAC
GCCCATCGTGTTGCTTGATTCGGCGCGTAGCAACGTGAGCATGGACCTGCCCATTGCCGAAGAAGACGCGAGTGGCATGCACACGCCGACGCATCCACTG
CCGGgAACGCCACGCGATGGTCGGCACCATCACTCTGCCACCAAGGTTGAACCTGGGCGAGAGGACGCCACGGGGGgAAACTTGCAACACTCGAACACGA
TGCTGGACATGCGGGACGTGACCATGATGGATGATGCGGACATGGAGATGGACGCCGATGACTACGACGATGACGACGACGAGCGTTCGCTCATGAGCGA
GGAAGCGCGCGgCGACGACACAGACTCGGAGAGTGACGACGGTGGTGAAGAGATCGAAGTGGACGCTATTGATTTCCAAGTGAATCGCGCCAGCGTCACG
CGCTCGGGTGTCATCCCGTGCTGTGTGTTCGTGGGGCGTGTATCATGGGGCTCCATCGACTGGGAGATCTACTTCGGCCAGAAGCAGCTCCTACGCCTCC
AGATCAGCATGTTCTTTTATCTCTTATACAAGAAGCATCGATTGTTACCTCGAGAGGTACGGCTGCCGTGGACGCTTATGCGGGAGAAGCGAGCCGAGAA
ACGCGTACTGGACGTGCACCTCGTGCAGAACTACATCCGTGCAGCACTCGCAGACGATGATCTGCGCAACTCGGATCCGTTGTTGAGTTTTCTCGAAGTT
AGCCCGTCACGAGCCATGTCGCGGTACGGTCCGTCGCTCAAGGAAGGATACGTACACATGCGTATGAACGGCGCATTCCAATTGCCtCTTTACACCTGTG
TGAACCGTACGATCGAAGCCTTGTACCGACATCTTTATCGTACATGGATGCGAATCGCATTCATCTCCACTGTGGTCACATTTATTTTGCCGATCAGTTT
GATCGTTGTGACTACGCTACCGCAGTTTCTTTCGGGACAAAAGACTCTCGTGACAGCAGACGGCGAAGATGTGGAAAGGAAGCTTGATGCGGCACA