Description :
From Genome Similarity Track
Location :
Scaffold_134:1227- 4221
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014983Protein of unknown function
Pytul_DAOMBR144PYU1_G014982Similar to Peg10: Retrotransposon-derived protein PEG10 (Mus musculus)

Sequence
2994 bases(100 bases per row)
GCGCAAGCGTGCGTGCTGTGTTTGAGGCTGTCTCGGATAGCCTCTTACACCTGGTAGCACTTCGTAGTCCTTTCAACGACCACGTCAAGAGTCTGCATAG
GCCGCTTGTGTAGCGTGCGCAGACATTCCAAGACCCCTGTCCGATTGTGAGAAACAATGGAAGGGATTGAGACGCCGATGGGCTCGATGCCTGAGAAACC
GTGAGCTGACGATGAGCATTTTCTCATTTGTCGAGCACGAGTGGGCAGCCCTCGAGCGTATGCGAGCGGTCATCGGTGAGGCGGCTGTGATCAGCTTGCT
GAAATCAGCGTCACCGGTTGAGCAGAGGAACGCGGCTACGAGCTTCATGCATCACGAGATCATGAACTCTCATCGACAGTCTGCAACTCCTGTCACGACG
ATGAGAGTAGCACCTCTGAAGCTCGATGTATCTCCGTACCGTGGCGGAGAGAACGAGCTCTAGCGAGATGTTCGTGAGTGGATGCAGCGATCACTGCAAG
ACAACTACGGGACCCAATACAGCAAGTGTGTTGCAATGTCAAAACTTGCGGGTCGAGCGAAAAGTTGGGCGTATGGGAAGCGATTGGCGGAGCCACATTG
CTTCTACGACCTGGACGACTTCAAGCGAGAGCTGAAGAAGGCTTTTGAACCTCCGCAGAGCGAATTTCGGGCTCGCGCAGAGTTTTTAAAGCTTCGTCAG
GGTAAATACGACCTACACTCGTACGCACAACGAGCTCGCTACTTGGTATCGAGCATCGTGGACGAGCCGATTGACATCCCAACGCAAGTCGTGACGTTCA
TGACAGGTCTGAACGATGGTCCGATTCGGAACCAGCTGTTCCGTGAGTACCCGAAGACCCTGGAAGGAGCCATCAGCCGTGCGATGCAAGAAGAATTCAG
CATCAAGCAAGCCAAATTCCAAGGTTTTCCGGCAAGACCACCAAGGCAACCAAACGTTGTTCATGATGGCCCAGAGCCGATGGACATCTCGTACATTTCC
ACGCCTGGAAATGAACGTCCTCGCAACGATGGAAAGTGTTTCCGTTGTGGGAAGCCGGGTCACTTCGCTCGGAACTGCAAAGTGTCTTTGTCTGATCGGC
AAACGGCACAGGGCTCGCGCTCGAACAACTACGACCGTAATAATGGTCGTCGGTTCGATCGTTCCCAAAGGTCAAAAAACGGGAACGACCAGTAGGGGCG
GGGCCTCCTACTGGGCTCGAGAAGAGGACTGTGAATGTTGTGGAAACACAGGACTCTGGCCCCAATGTGCATGATGCACATGCAGTTTCCACGAGTGAGA
AGAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTCAAAGTTCATGTAGACGGTATTGCAACGCCTTCTACGAGCTTTGGTTGACACTGGTGCGTCGAACA
ACTTTGTTCGAAATGAAGTGATTGCCAGGCACAACATCTCTGTGCCTGTTGCAAATGAAGAGAAGACGATGATTGTTCGGTTGGCCAACGGGTCAACTGT
GAAGATGCCAAAGCGAGTCGTTCGCTTGGCAATGAAGTGTGAAGATTTCCGAGGCGAGGACGAGTTCATCCTTCTCGACCTCGATGACAAGTTTGACATC
ATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAACATGAAGATCTCCGTTGACAAGTCATGCAGCGCTGACTTGAGCAGCA
TGACAACGGATGAAGTGGTATGGGTTTATACATCTGTGGAAGAAATCTCAGATGGCCCTTGTGATATTGCGGTGTGCGATGGCCCCCCATGTTCACAAGT
GGCACCCATTTTGAAGAAGACAAACGGAGGTGGAGCAGTCAGGCGCCAGAAAAAGACTGTCTCCTTTGCCATCGACGACAAAGTTGCGTGCGATGGTAGT
ATGAAGAATGACGGGAAGATAGGCAGAGACCCGCCCCAAGACAAGAAAAAGAAGACCAGCAAGAAGAGTGTTTCATCAAGAGTTTCAAGTGCCCCTGATC
AAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGCAAGAGTCACTTCGAGCGAATTTGTGAATATCGCGGTCTGCAAGGAAGAAGGTGACGTGAATGT
AATCCGTCACGTACAAGTGGAAAATCCTCCAAGTTCTGTCCAAGAATTGATTTCCTTGCCATCGATGAGCAAGAAGACGCTGAAGCGTAGCCTAGCGAGA
GGCGAAATCTCGCAGATCTGCATGATCGTCGATGTTGGCGATGCAGAGGACATCAGCACAGTATCAGCAATGGAAGCTGAAGTGCTTGATGAGAAGACAC
GGAAGGAAAGGTTCGAGGAGCAGTCATGGGACGCTCTCAAAACCAACCCCGTGTATGCACTTGCCAGGGAATTTGAAGACATTTTCCCAGACAAGGTGCC
GGACGAATTGCCATTTGATAGAGGCATTCGTCATGAGATTGACGTACTTCCTGGCACGAAGTACTGCATCACAAGACAGTGGCCGTTGCCAAAGGAACAA
GTCGATGCGATTGATGAGTTCTTTGCGCAACGTGCAAAGGCTGGCCATGTGCGAGAGAGTAAGTCTCCGCATTGCAGCCCCACTTTCTGTGTGAAGAAAG
CAACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACCATACCTGCTCAAACTCCGGTTCCACGCAAGGACATGATCCTTGATGG
AATGGTTGGCAGCACCGTCTTTAGTGCTATCGATCTGAAAGATGGATTCTATCAGATTCGAATGCGCGAAGATGATGTCCCACTAACTGCAGTGAGTACC
CCTAGTGGTATGCTGTGGGAATGGTTAGTGATGCCACAGGGACTGAAGAATGCTCCTGCGACCTTCAATCGAATGGTCACGAACGTTCTTCGTCCTTTAC
GAACATTTGCACCGAGTTACTTTGACGATATCTTCGTTCATAGTAAGGCCACGAATGGGAGATCTGATGTTGATGTTCATCTTGATCATCTTCG