Description :
From Genome Similarity Track
Location :
Scaffold_26:122692- 127822
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009513Similar to Ppef1: Serine/threonine-protein phosphatase with EF-hands 1 (Mus musculus)
Pytul_DAOMBR144PYU1_G009512Similar to SF-assemblin (Spermatozopsis similis)

Sequence
5130 bases(100 bases per row)
GATGGACACGGAGGGGCTGACGACGCGCGGCGCGTGGGGCATGGGCCTCATAGTCTCGCCCGAGCAGGACCCAGTGAACAACTACGACGAGGACCACAAG
CTCATGGAGGGCGCGCTGATCAAGCTGGGCGACTACGCGCACTTCCGCTACTTCCTGCTCTACCGCAACGGCCGCTTCTGCTACTACGAGCTGCCGATTC
CCGCCGGTAGCCCCGGCGGTGGCACGCGACGCGTGCACCTGACGCTCACGACGGACCACCTGCGCGGCGTCATGATGCTCAACGCGTCGCTCCACGCGAA
AGAGCTCGCAAAGAACGAAGAGGAGTACGACGCCGACCTTATCAAGCGCGGGCTCATGTTCAACCGCAAGAACCTCGAGATGAACCTGACAGGGTACTCG
CCCACGGGCCAACTCATGTCGTGGAAGCTGCGCGCGTCAAACGACGCCACGTACGTCAAGTGGGAGCGCGCATTCCGCCTCGCGCTGCGCCCCATTTGGG
TGCAGAACACGCACGCATGTCTCGTGTGCCAGAAGGCGTTCACATTTTTGTTTCGCGCGCATCACTGCCGGTACGTTTTTGTTATATAGTAGGATATGTC
CGTGTGTGCATGACTCTAGACTAAAAGCTAACTCTTCTGCGCTTGATCACATGTTTGATACAGCAAATGCGGTACGTGTATGTGCGAGGAGTGCTCGGTG
TTTGTCCCGCGGCTGCCGATGCAAGGGTACTACGACGAAGTGCGGATCTGTCGCGATTGCTCGCCGGTGCGTATCCAGCGCTCGTCGCTGAAGAAGGACA
CGCGCGTGCTCGTGTACGGCATCTATCCCGGTCGTGTGGTGCAAGTCGAGGCGGCAGACGACTCCGAGGGCGGACGCGCGTACGTGAACGTGGAGTTGGA
GAAATCGGGTCAGGTCCGCAAGTTCGCACTCGAATTTGTGGAATTGTACTCGGAGGCCGTCTTGTCGGCGAACCGCATCAAGAACGCGATCCGCTTGCAT
CTCTCGCAGTCGCTTTTCCGCACACAACTCAACTTTTCCACGTGGAATCTTCTCGAGACCGTGCAAGAGCAGAAAACGGTTCAAATGGTGCGTAGCCAAC
GTGTTTAGCTGTTGCTTTTGTGGAACAGGTTGACTAATGATGTCTTTGTTCATGCTGCTTGCTGCGCTGTACAGGTCCGCATTCTCAACAAATCGACGAG
CATCACGGAACTGCGCTCGATGGTGCCAAACCTCGGCTCGCTCGAGACGTTCCAGTTCCCGATCGACGACGAATCCGAGAGCGACAAAGTGCGTGCGTCG
CTTGCGCACTACCGCGGCGTGCACGTCGTGTTTCCTCTTCGTCTGGATACGGTGACAAAGTTGATTGACCAATTCCGCAACGGCATCTTGCTGCATCGTG
TGTACGTGCACCACATTCTGGAGGAATCGGAAAAGATGTTTCGCATCGTGCACGCGTCGCCGATGAACGCAATCGAGATCCCCGCGGGCGTGACGCTCAT
CGTTGTCGGCGATCTGCATGGGCAACTGGAAGATTTGCTGACGATCTTGGACAAGAACGGCGTGCCGAGCCAGAAGATGTGGTATCTGTTCAATGGCGAC
TTTGTCGACCGCGGCTCGCATGGTGTGGAGGTGATGCTGTTGCTGTTGACATTCAAGCTGCTGTACCCAAACTACGTGTTCCTGAACCGTGGCAATCACG
AAGAGCGCATGATCAACGAGGTGTTCGGGTTCGAGGACGAAGTGTACGTGAAGTACAACACAGACAACGACGAAACACTCGGGTGGGAAGGATTGAGCAT
GTCGGCGAACTACTCGCCGATGAAGCTGTTCCAGATGTTCGAAGACATCTTCACGCTGTTCCCGATCTTCTCGCTCGTGAACGAGAGCGTGTTTGTGGTG
CACGGCGGCCTTAGCCATCACAACAACGTGCGCATTGAGGAGCTACTCCAGATCAAGCACCAGCGAGAGATCCCCACGCAGAGCACGGAAAGGGAGGATG
AGCTGTTTACGCACCTGCTTTGGAGCGATCCGCGCGACCGCAATGGGTGGAAACCATCGGGGCGAGGCGCAGGCGTCGAGTTTGGACCAGATATCACGCG
GCAGTTCTGTCAGCTCAATCATCTGTGCCTCGTGATCCGGTCGCATGAATGCCGCGAAGAAGGGTACGAGATCACGCACGACGGACTGCTGCTCACGGTG
TTCTCGGCGTCTAGCTACTGTGGATCGCAGACGAACAAAGGCGCGTTCGTGCAGCTGCAAACCATGGAGCACGGGGACGTGAAGCCTCACGTCGTGCAGT
ACTATGCGCAACCGCTGCAAAAGCTTCGCGATGCTGGCAAGAACGAGTGGCGACAGAAGGCGTTGCGGCTGGAGCGGCGCACGCTCATGTCGCTTGTGGA
GTTGATCTGCGAAAAGAAAAGCTCGCTCTGGTCCGCGTTTGCGCGTGTGGATGCCAGCGGCACGGGCCGAGTCACGAAGCTCCAATGGAAAGACATGCTG
CAGCGCACCCTCGGTATCGAGGTGAACTTTCTGTCGTACTTTCGCCAACTTGCGACGTTAGAGCAGGATGCACTGGGTGGCGTGGATTACAAGAAATTTC
TGAACCGGTATACGGTGGAGTTGGGTGGTGGGAACGCGGATTGGAAGAAGCAGATCGCGCAGGAGATCTGGTTGGGGTTCTCGCGTGCGCTCGCGCAGAC
AGGGGGAGGGAGCTCCCAGCGCGGCGGAGATCCGAAGATGACGTCGCAGAACAAGCTCCAGGCCGCATTTGAGCTCTTCCAGCTCACGTCGCAGTACAAT
AGCAATGTGAATGGGTCGCCACCACCCGAGACGAATGGCGGCAGCACGATTAGCTTTGCATCGCAGCGTAGCAACGAGAGTTACCTGCACAGCGGCCTTG
TGACGTACGACGTGTTTCGCGCCACGCTGCAGCGCCATCTGGTGCTCACGGAGACGCTCTCAGAGCAGCAGATCTTCGAGCTGATGCAGCAAATGGACCA
GAACCACGACGGGTTTGTAGACTTTGGCGAGTTTTGCACGTTCTTCGCAGAAGTGAGTCAGTCGGATTTCCTGCAAACGCTGTTTGACGGCGAGGACGTG
AAGGCGATCGAGTGGCTGCATCAACTTGGCTCGCGGTTGCAGGAGTCGACGCAGTTCGAGTCACTCAAAGGCGCGTTTGTGGCATTTGACCGCGGACAGA
AAGCGCGTTTGGACATTGACGACATTCTCGCAGCGTCCAAGACCATGGAGCTTTCGCCTACGCTCGACGAAAGCGACGCGAGGCTGCTGTACGACTCGAT
TCTGCGCAGTTACTACGGTGTGACGATGCGCAAGGAGAAAGAGCAGCGCGGGCTGGACTGGGAGGTGTTTGAAGACGTGTTCTCCCCTGACAGCACGCGG
CAGCGGCGTATGCGTCTCGAGAGCTGGAGTGCGTCGACGACCAACTTGGCGGCGCTGCTCGAGAGCGCACAGCAGCAAACAGGATGCGATGACGAGAGCG
GCACCGAGAGCTCACCAGTCGCGGGTGCGTCGGCGCGACGCAATACGTGGGCCGAGACGCTCGTGGACTCGGTCAAGCACTCGCTGCACGAGCAGCGGCT
GTACCTGAAGCTGCTCTTCCGCATGCTCGACCGGAAGCGCGCGGGGTACGTGTCCAGGGACAAGTTCCTCGCGGTCGTGAACGTGATCAACGAGCAGCAC
GGCTCGTTCTTGGACCACGACGAACTGGAGCAGCTCGCGGCCTCGTTCGCGTACCGTAAGGGTGTCAAGCGCGCGGCGTCTACGGGGGGTGAAGATGTGC
AACCGCAGGAGGAGCAGCCGAGTGAAGTGGCGTGGGTCGCGTATCCGCTGTTTCTGCGCAGCCTGCGTGTGATCGACTCGAAGTGCAAATGCTGCTAACG
AATAGCGTGTAACTTAAAAATAGAGAGAGTATTGTAGTTTGGTCTTCTGTTTCTGTGAACTTTATTATCTCTTTTCAGTACGTTCATTAGGTTGTGAAGC
GACACACTGCTTGTTTGGTACCATTTTTCACTTTTTCAGTATTGCGCGAATGAACCAACGGCAGCAGGACGAGAGCGAGGGTGTGGGCACCACGCCGCCA
CATCAACAGGAGGATGCACGCGACGAGGTAGCCGAGCAGCTCGGCGCCACGGCCACGAAGAGCAAGCTCGACAAGCTCATGACGGACTTTGCCACCTTCG
ACGACGTCATGCGCATCGGCACGCGGGTACGTTTGCTTTCTGCACGTGCATATGCATAGGTGACGCACATAATAATTACTGCACTTTAGCAACGCAAAGA
GCGCGACGAGCACCGGCTCGCTGAGATGCAACAGGAGATGCGGCGGCTCGAGAACAAGCTCGAGGCCGAGATCAAGAAGCGCGTCGAGATGAACAAGTCG
TTGCAGAACTACTGCGACGAGCAGGTGACGCAGATGACGGCCAACTTCGAGCTCCTGCTGCACGACCGCGCGACGCAAGTGCACGGCAGATTAGATTCGC
TCGCGAAGGAGATCGCGGCGTTGCAGGCGCTCGTGGTACAGGAGAAGGTCGATATCCCCGCGATGATCGAGCAGAAGACCAACGAGCTCACGCTCAAGCT
CGTCGCGTTCATGGACGCGTTTGAAGACGAGCGCAAGCGTCGCACGGCGCAGGAAGAGGCGATCCTCAAGCGGCTCGGCGACCATGAGCACGCGACTGCC
GAGACGTTTGAACGAGAGCGGGTGCGGTTACTGCTTCTGGAGTGTTGCACCAGACCCCATGGAATGATTCTGTATGTGTATTTGCGGTGTATGCTTGTTA
GCGCGACCGTGAGCTTAAGTATTCGTTGTTGAAAAACGCGCTGGACGCGTACACGACGAACCGGATGCGCGGCGACGATCGCTTTCACTCGTTCGCGCAG
GACGAGATCGCCAAGATCCAGAACGCGCTCGTTGCCGAGGCCCAGGTACGTGCATGTTGTGCTTGTAACAAAATGCACAAGGACGTGGACTGACTTCTTC
TCGCTTCACCCACGCGCACACAACAGTCCCGAGAACGCGAAGACGACGAGATTATCGAAGCACTGAATCGGTACACAGCCAAGCTCCAGGACAGTCTCAA
GGTCATCACGAGCCCCGACGCATAACAAAC