Description :
From Genome Similarity Track
Location :
Scaffold_26:12267- 13369
Sequence
1102 bases(100 bases per row)
TCCCTACTCTTCTTCGTGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGGTCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCCGCC
TCGTCTACCCAACTAGGTTCGTCATATCCACGCCAATGCACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGATCTCATATCGGTGA
TCTTCTCGACTTCGAACTCGTTGGCTTCGAGATCCACATTCCAACTGTCTTCCGGTAGGAGAACCTTGTCGAAGTCGACGCGGTCGGATGCGTCTACCGA
AAGACGGATTTGCGGCCAATCTGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTTCCGTTTCCAGC
CTCACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGCCCATGCCATAGATGGGCCAATTTGCGAGCGTACCCTTCTTTCACTCGATCCAAATAAA
GCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGTGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTG
GGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGGATGGCCGCTTCTAGG
GTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACT
CATCCCAATCCCTTTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGGACGAT
ATGCCATGGTTGCTCGCTGTCGCTGCCCTAGGATCCGGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGGTCATGTCTAATCATTTCGC
TAGCACCAAATCTTCGGAAAACACACTCCTCGTACGATTCTGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCAATCACATATCCGGTAAACAG
GT