Description :
From Genome Similarity Track
Location :
Scaffold_3:122635- 130233
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_01272predicted protein
Sappa_CBS223.65SPRG_01273Hypothetical protein

Sequence
7598 bases(100 bases per row)
GCGGGCGACCCGTCACAGGGTCCTTGGTCGTAAGAAGATCGAGGACTTGGGCGTCGTCCGCGGCGAGCGGCGTGGCGGGTGCGAGCTCTGGCTGGCACTT
GCGAGGCGCTTTTGCGGGCCACTTGTCTTCATCGTCGCTGTCGGCGACTTGGTTCGAGACAAAGCCCACAGCGAAGAAGGCAAAAAATACGTCAGCGAGA
GCATGCACGCCGCGGCAGCGCCGTAGAGGACGAGCGGGTTCGGCTTCGGGGCGCGGTGGTCGAGGCGGTTCTCGTGCGACAAGAGGGTCGCGAGCGAGAC
GACAAAGACGGCGATGACAAAGTAGTTGGAGAGACGGAAGAGCTCCCAGCGCGGTTGCGACGCCTTCGGACCCTTGGGCTTCTCCGGCTCCATGATGTAG
CTGAGGAGGCTAAAGCACGTGAGCAGCAAGAGGCCCCAGAAGAACTCTTGCGTGTGGTCCACGAGGAGGGCGACGCCCCACGCGAAGGTCGCCTCGAGCG
CCGAGCGCACGCTCTCGGTGCTGATGAGCACGGCAGCCGTCAGTAGCACCAGCATCGCGTCCGTCTTCTTCGCAAGTGAGGTGGCCAGACGATGGTGACA
CACGCAAGATCGCACATGTCGCATCCGCATCATATCCGGATACCCACCGCGACAATTGGGTGCATAAAAACTCAAGTCACCCTTGCTGCGAAGAGGATAC
AACGCGCTTCGTTCGATCCTGCTGCTGCACAGAATCGTTCAGTGCACTTGATCTGCGTGCGAATTGATGCGATCTGAGAGGTTCTGAGGCGTGGGCACGT
CACACCTGGAGCTTTCCACGTCGCAACAGTCGTTCAAACACTGTTCGCTTATGGTGCCACTGCGCTCGACGTCAGAGTCTCAGCAACTTTGCATACTCTG
ACACTGCATGCGCGTCTGCAATTCGTCATTTAGCACGTTTAGGACGCTCGTCAAACCGCTTTGCGGTCGATCGCCCGCGCCCGAACTTCGCTGCCGCGTG
CGCAAACTTGAGCGATTCAACATTGATATCCTTCCGTATGCGAGTCGCGCGTTGTGTGAGACTCCGTGCGCCTGTCGGTCTGTATCCAGTCGTTCAATAC
GCCCACTCTCATCGCTTGATGGACCACTTTGCGGTGGGTCGGCTACGCCTCAGAACCCACCTGGAACACAGCCCTCGGTCGCCAGCATTGACGTTTGAAC
TTCTTTCTCTACACCATGTTCTCGTCCGAATGATCAACGGCCCACTTTCGCTGCAAGCCTCTCTCACTGAACTTCAATCGCAAGCATCCCTAAGCACTGC
GAGCCAACATATTTACAGTGGCGTATGTCCCTTGGTGACGACGGGTACTAGCATTCGAGGGACAACATGCTCCCAAACCGGCACCGCCCCAACCCGCCCC
GCCCTTGCCATGGACAAGACAAAGAGTGCTGCCAAGTTGAACGCTGTGGTCCTGCCGGTGACGAAGCGCACTAAGGCGTCGCCAGCCAACCCGAGCACCC
ACGAAGCGATGGCCAACGCGTCAAAGGCCACGAATCCCTCGGCAAGGCGCTCACAAGCAAATCTCGACGCTACAATGCTCACTAGGTAGTCCAAGCGCTC
TTCGTCTCGACGACATGTACCCAATGTCTCCTCGTCTGCAGCCGTGCACCAGCTCACGAATGACGTCAGCCAATTGACGCGCGACCACGACGACGCTGTT
CATTTTGCGCATGGGTACCGCTCCATGCCCAACTTTAACGTCATGTGGTCAGCGCTACGGTCTGGCGAGTGGCTCATCGAAACAACCATCGAGCTCGCGT
TCGCGGGCATAATGCAGCTTGATACGGAGCAAGGGCGCGCCGCTCTCGATGCCATCGGGCGCGGTCCATCCAAAGGTGTCATTGGCTTGCCCTACGCANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
ATGGTATTCTCTCCGCCGCTTCCCAAGTGAACATGCGCTGAAGCTTATTTGGTGCATGCTATCGCTAGCAGAGCGCTAGAAAAATATGCAACGCGGCCGC
AGTCACCTGGGAGAGAAGCCACATAACATCAACGCCACTCAATTGCAATTTAACGACGCAAGCGCTCATATTGTCACGTTAACTCCTTGAGATGACCACT
TCTAACTGAGTCCAGGATAGTCAGGTATAAATGCTTGTAGTGCTGACATCGGTCGCGTTATTTGTTGTTCACGTCCTGGTTCTCTAAGACTCTTTGTCTA
GTACGGCGTAGCGATGAGGTCGTTGTCTAAGTAGTGTTGACGTTCTGGTTTTTGAGACACCTTGCCTAGTACCATGTTAGCATACTATAGTGGTTATGCT
TATTTTATTGTGTGCGCAGTGTAAACGTTGTAAGGCTAGAGACCAAGAGCAGTGCGCGTTTCGCACATAAAATTCAGTCAGACCTTACCACAGGCAACTA
CAATACGTACATGTGCAAGCTTAAATTGCAGAGAAGACAGCAACATCTAATTGCAGTAACTTGCTTTTGATGTACATAGATAGATGCTGCGTTACTACAC
TGAGCGGTAGGGAACCGTCGTCAATAGCGTCGTGCCACTGCGACAGCGGGTGGACTTTTAAGTGCGGACGCCGTTGGTACTACAATCACTACGCTCGTGA
CTGCCGCTGCACCTTCGCATATCGCGCATGATAGAGACGTTTTGTACTTGCATGGTAACCAAATGGTGGTATAAGGCGGCAAGCTTTGAATCAAAGACTT
GCTTGTGAGCACCGTCCAGAGACGACGCGACCCACAAACACAAACACGATGCTCTCGTCTCTGTCGCTGCTGGACAAGTCTTGACCAACGTGACGCCGTG
CGGCAAACAAAGATCTAAACTAGGTGTTTATATAATTGCTTTTTGTTTTAAGAGGTTGGTTATCCGTAAATTTTATTGCTTGTCGTCAGTGGCATGTCAT
TCAAAGCCTTCTTTCCGCAGAGATCGCCATCAGATCAACAAAACTTGGACAACGACCTCATCGCTACGCCGTACTAGACATAGAGTCTTAGAGAACCAGG
ACGTGAACAACAAATAACGCGACCGATGTCAGCACTACAAGCATTTATACCTGACTATCCTGGACTCAGTTAGAAGTGGTCATCTCAAGGAGTTAACGTG
ACATTATGAGCGCTTGCGTCGTTAAATTGCAATTGAGTGGCGTTGATGTTATGTGGCTTCTCTCCCAGGTGACTGCGGCCGCGTTGCATATTTTCTAGCG
CTCTGCTAGCGATAGCATGCACCAAATAAGCTTCAGCGCATGTTCACTTGGGAAGCGGCGGAGAGAATACCATAAAGGCTACATTAGTGGCCGTTTCAGC
ACCCTATACCAGTCGATACTAGATCGTCAGACTGCTTATTGCATTGGGCGGTGTGACACATGCCGCTCAAATCAATGGACACAAAACTAGCTTCTTTATA
TATATACTGCTGGGATAGCCTATCCGGCAACGTTCAGATAGAAATCATAGTGAAAAACTGCGCGCCAACAAGTGTTCTACGCTACGCTACGCTATGCGGA
AACTGCGTGCGCGTTTGCTCCGCTCGTGGGGCCTTTCAGCAGCTGAGTCCAGCTTCGCCACGAGTCAGGTCGAGTTTTGTGCCACGAATGCGGGTGAAAA
AGTCCTATTGCGTTAAGCGATTGAATGCTTTTAAGAATAGGTAGAATAGGCAACTGCACAGGCGAAAGGGTCTAATGGATTACTCGGTTGAGCAATAGTT
CTAGCCTACAGTAGAGTAGAGTACTGACCACGAGATACTGCGATCAGTGCAGTGGTCATCATGAACATTCTTGGCCGTAGACCTGTAACGTATTTATCGG
AGCAATGAGGTCCCAAGCTGCGTATTAGCTGCGGCAGAGCGCATGGCGGATAATTCCAAGATCAATAGTCTAACTCACAGAGTTTGCTCTGTGTGAGGTT
GCAATTTGTCATCTTGCATCCATCGCGTTCGTTATCGCCCTCAGTTGCGATGGCCGCCTTAGCATCTGCCCCTGACACTCGATGACTTGAGGAAGGCAAC
TTCTCGCCAGCGTCTGGCATTAGATAGTCGGATGATTCAATAGTCGGATGATGGATGATTCGATAGTCGGATGATGACGGCCTATGGTCAGTGTCTGGCA
CTGGAAGGTCGAATGATGACGTCTTGACGTTAGCGACGAACTCGGCGGCTGGATCTGAGTGGCTGTCAACCGTATCATTCACGGCGGGAGATCTTTCGCG
CTTGGCCTCGGTGATAGGCTCTGTATTGCTGTCTGTAGCATTGCTCCAAGCATTTGCAAAGTCAGTATTCTTGTCGTCCAGAGGTTTTCGGTTTCGTACA
TCTTGGTGACAATTTTGTCATCTGCTTCATCGATTACAATCACATCGTTTGTGGTCGAGATGGTCTGCGCATTTCGCGACGGCAACAGCAGCAATTATCG
CTACTTGCACTAAAAGTGATATGTCATGCTTAAAAAGCCTCCAGTGTTCTGGAACTCTACAATGTCTAAAAGATTGAACCCGGGACTCGAGAACGATGTC
ACGCAGTACCGACGACAAGGTGACTTGTACCGTCAACTGTACGATGATGATTCGGGTTGCGGGCAAGCCCTCCTAAAATAAGGTGCGGTGTGCGAGGAAC
GTCGTTCGATAACTCGACAAGACGCTGCAGTAGTCCATACATATACCGGACGATTTATCGAGAACGGCAAGCGGCGCGTCATCCGCGCGATGGCAGTGAG
TGTTTATATACATATCAACGCGTTCCGCGTTATCTTAATTACAAAGCACTGGGTCGTTGGGAGTGAGCTGTGCACGGAAAATCCATTCCGTGTTGGACCC
TACTCGGAGAGGGATAGCTCGCTCGAGGTCGTACGCAGGCTCCTCTACTCGGACCAAGAAAGTGGAGATGCCCCAGAGACTAGCCTAGAATTATTCCAGG
GGCTTTGTTCAGAAGACAGCTCCGTCGCCGAGAGAAGGCGTCATGATTGCGGACGATGTGTCTCCTAGTAGGGGCATGACGATCGCAGGTCGATAACCCA
GCCTCATACGACTGCGACATAAATCCATTGGCGCGAGCCGCAACTGGTTTTCGAGGTGTCGGACTGGTCCGTGCTCCGGATTCTGGTAGCATTCAGCTCA
GGGGTCGACTGGCTTGTGCTTTTATAATGGGGATTCGACACGACTGTGACCCTGTTGTCGCTAAGCACTGCACTTGAAGTCAGATTTGAATCCGTTCCTT
TATGGTGTTGAGAATAACGGATCAAAGTTAGCCACGCAGTGGATATTTTTTAAAATGACGAATATGCCACAGTCGTAGCCGTACGGTTGTTGAGGCACCC
GCGAGACGACGCAGCCCAGATGGAGGTGGTTGGCGAAGAGCGAATCACTGAAAAGACTAGCTAAGTCATCAGGAAACTCGAGGAGCTTCAGGTCGTGCTT
GTCCGACCTGCCGCTAATGTTCATCGAGTCCAAGATTGTCGCCCACCCGTGGGAATCACCCGGTAGAAAAAGCAAGACCCTGCTAGTAGACGCTATGCTT
GGAAATGGGCACGATCTACAACGGGCATGTGCGCAGGTTGGTGGCTCCGTTGTTAAAGCGCATAGCACCTCGTTCGTCTTTGGTGATGCGCGTTGTCCAG
TCCGTGGGGCTCCTCTTGTAGATGGCGTAATGGCTCATCAAGACGAAAGCAATCGCGTCGCCCGTGTCAGCGATGGCCAATTGCATGAAGAGCTCGATGG
TTGTTTCGATGAGCCACTCGCCAGACCGTAGCGCTGACCACATGACGTTAAAGTTGGGCATGGAGCGGTACCCATGCGCAAAATGAACAGCGTCGTCGTG
GTCGCGCGTCAATTGGCTGACGTCATTCGTGAGCTGGTGCACGGCTGCAGACGAGGAGACATTGGGTACATGTCGTCGAGACGAAGAGCGCTTGGACTAC
CTAGTGAGCATTGTAGCGTCGAGATTTGCTTGTGAGCGCCTTGCCGAGGGATTCGTGGCCTTTGACGCGTTGGCCATCGCTTCGTGGGTGCTCGGGTTGG
CTGGCGACGCCTTAGTGCGCTTCGTCACCGGCAGGACCACAGCGTTCAACTTGGCAGCACTCTTTGTCTTGTCCATGGCAAGGGCGGGGCGGGTTGGGGC
GGTGCCGGTTTGGGAGCATGTTGTCCCTCGAATGCTAGTACCCGTCGTCACCAAGGGACATACGCCACTGCACTGCAAATATATTGGGTCGCAGTGCTAG
AGGATGCTTGCGATTGAAGTTCAATGAGAGAGGCTTGCAGCGAAAGTGGGCCGTTGATCATTCGGACGAGAACATGGTGTAGAGAAAGAAGTTTAAACGT
CAATGCTGGCGACCGAGGGCTGTGTTCCAGGTGAGAAATAACGCGCGGGCGCGTCACGCCTTAAGCTTTCCACGTCGTGACAGCAAACGCGAGCGCGT