Description :
From Genome Similarity Track
Location :
Scaffold_98:12262- 14667
Transcript NameFunction/comments
Phyra_83841serine protease family S28, putative
Phyra_83842Drug/Metabolite Transporter (DMT) Superfamily

Sequence
2405 bases(100 bases per row)
GACGGCAACGCTCGCTGCACTGCTGCTGGTCGCGGCGCTCTCCGCGAGCGCCCAGGGCTACACGTTCCCCTCGCATGCCAAGGACGGGCGCCTATGGCGA
TTAGTGCAGGCGGAGGACCAGATGCTGTTCCAGGCGGGCGCGCAACAGCTCTGGTTCAGCCAGCAGGTGGACCACTGGGCCTCGGACAGCAACGCCACGT
TCCAGCAGCGCTACTACCAAGTGGACAAGTTCTGGAAGGCGCCCAACGGTCCCGTGATCCTCTACATCGGAGGAGAAGGCGCGCTGGAGCAAGCCCCCGC
CGGGTTTGTGCATGTCATTGCCCAGAAGTTCGGCGCCAAGGTGTCTACTGCTCGCAACGGCGTTGAAAATGAATAAGCTTGTCAGACTCATAAGTATACT
TTGGTGCTTGTGTTCTGCTAGATCCTGGCTTTGGAGCACCGGTTCTACGGCAAGAGCATTCCGAACGGGGACCTCTCGACGACCAACTACCGCTACCTGA
CGGTGCAACAGGCGCTGGCCGATCTCAAGCACTTCAAGGAGAGCTACCAGAAGCAATTAGGGGCAGAAGACGCCAACCAATGGATCGCAATTGGGGGGTC
CTATCCGGGAGCTCTGTCCGCGTGGTTCCGTGTTGCCTACCCGGATACGACGGTAGCGTCGTTGTCGTCGTCGGGGGTTGTGCAGCCGGTGTACAAGTTC
CACCAGTTTGACGAGCAGGTGGCTCTAGCTGCGGGTCCTTCGTGTGCTGATGTGCTGCGCATGACAACGGCAGCTTTCGAGAAGGAGATTGCGAGTGGCA
ATGCGACCACGGTGAAGGGGATGTTTGGCGCAAAAGATTTGGCTGACGCCGATTTCTTCTACATGATCGCGGACGCTGCTGCGATGGCTGTGCAGTACGG
ACACAAAGATATTGTGTGCGTCAGCATGGTTGGTGCCTTTGAGCGCAACGATTCGCTGGTTGACTCGTTTGCCAGTTTCACGATCGACATGTATGGCGCT
TCGTTTGGCAGCGGATGCTTCTACGACACAAAGTGTCTTGCACACGACAGTGCGCGCTGGGGGGACGGACGCTCGTGGCGCTGGCAGAAGTGCTCGCAGC
TCGCGTACTTCCAGGTTGCCCCCAAAGAGAAAAGCCTGCGCGCTGCAATGGTAGACCTCGACTACCACCTGAAGCAGTGCAGCCTTGTTTTTGGCGACGT
CGTGCATCCGTCCGAGGGCGTGGAAGAGATCACCAAGCTGTACGGTGGAGACCACCCGGATGGCCACAAGATCTTCTTCTCAAACGGTGGGGATGACCCG
TGGCAACGTGCTTCGGTGCTCGACACGCTGTCTGACGATGAGATTGCTAACTTGGCCAAGTGCGACTTGTGTGGCCACTGCGGTGACCTGCGTGCCAATC
CGAATGTGCCCGAGCCGTTGAAGAAGCAGCGCGAGCAGATTCTCGAGTACCTGGCCAAGTGGATGGGTGTGTCTGATGCCGTGGAATTCGTGGAGAACGT
TGTGCACGAGGCAGTCGCTATTCCTCATCACGCGCAAGACGATGAAGATGGTGCGCAGGAGATGGCGGGACTGCAACTTGCCGGACTGCACAAATCGTCG
CCACTGGTCCTTATTCCCATTGTTGTCGCGTTCCTTGCGTTAGCGGGGGTCCTGCACGCTGATGTTGTTCGCGACGCTCCGGGGCGTATGGATATGATAC
GATACCGGCTTGCGCACACGCACGAGTTTTGAGAATTGCGGCAATACAGACGCCCCAAAGCTCGTACGAACCGAGGTGGGCTGTAAGAGTTAGAGGCTTG
TAGCCTGCCTGACGTACACTACGCTCGATGATGACTCCGTGCTTGTATCTTCAACTTTTTTTATTTTTCTCGAAAATGAACATGCACGTCCATTCTAAGC
CTGTGTCTATAGCATACGCATGAATATTGAGGAGTCTCGCACACTTGCGTGGTGATCAGCAGCGGCCGAGACAGTCTTATGCGCTCTGCGTCTGCGCCTT
GGGTTTAGCTGGTGCGGGAAGCGTGGACTGGCCCATTGTCTCCTTCGTCGAGATGTAGGCGTACGTGGCGCCTCCAATAGATACAACGATGATGCCGATG
GCCTTTTGCACAGTGATCACGTCGTTGTTGATGAGGATGGACATGACGATCACAACCACCTGCTTCATGTTGCCGCACACGCACAGCGTCACCGGAGACG
TCACCTTGTTGGCCATGAAGCTCGTGACGTTTAGCATGAAGCTGATGATGCCGGTCAGGATGAACCAGAAGCTAGCTGACGGCACAACCTCCCAGTTGTT
CATGGCCGTGTTTACCTCGCCCGTCAAGAACATGGTGATCAAACACCAGCAAGCGGACAGCGGTGCCTGGTGCAGGATGAGGTCCACCGGGTGCAGCTTC
AGGTC