Description :
From Genome Similarity Track
Location :
scaffold_936:1226- 9295
Transcript NameFunction/comments
g10649.t1 conserved hypothetical protein
g10650.t1 arginine biosynthesis bifunctional protein argJ, putative
g10651.t1 conserved hypothetical protein
g10652.t1 hypothetical protein PHYSODRAFT_342082

Sequence
8069 bases(100 bases per row)
TTGGTCTAGGTGGACAATTACTGGGACCACTGGCTGCCTCAACAAACGCTTCTCGAACGTTGATACCATTACGTAAAACCCCAGCGGAAGTGTTCGGCCT
GCGCTCCAGTCGAGCTAGAGACGCAGCATTGACTGCCTCGATATTGGAGATGCCATCGATACTGCCTTTCCTTCGAGAAGAAGTCCGTTTGGATACGTTA
TCTTCTTCGTAGAGGGATTCACGCGGAACCCCAACCTGCGACGTACCAACACTGTCCAGCTGCCAAGTTTTAAGCTCATCGAGGATGGCTTCGCGTGACT
TATGCTTGTGAGTGTCGAACTCTCGTGCTCGGTCCAATGTATCAGTGATGGAAATCCTTTCTGCCGGGGTCTTCGGGCGATCGGGTAGTCCGTGACTTGA
AGGAGGTCGAGCGTTCGCCGTACTCGTTTCAGAACTGCTAGGTGAAAAGGTACGAAGGTTCTGTGTCACTCCGGCTTCTGCTTCGTGACGATGCCGACGT
AAAGCACTCGAGACGTTCCCTGCGAATACAATATCTGTCCCATGAGTAAGACGGCTACCTGAGTCGTCGTTACGAGGCGATTCGACTGGAAATCCGTTGA
GACTAGCTGTGCTAGACGAGTATGAAAGCTGTCGAGGACTGCTGATCTCGATCGCTCGTAGGTTACTTGCTGAATTACTGGCTGAAGTATCGGTTTGAAG
CTGGTCCTGGTGCTTTTGAATCGCCGTATCAATCTCCACGTCCGAAAGTTTAGCCCGTTCGTTTGTGGAGAAAGCTCTGTCGTCTAAGGACGCGAGTTGT
GGCACGAAGTTGGCTATAATCTGTCGGTAATGCTCGAAAGTCTCAACAGGATTTCCAACCAAATGCAACGACACTAGCTTCGGACAAAACGCTACACATA
ACAACAGTACTTAGTAGACATGTTGTGCACGCGTAAGTTATAAATGGATTCATACCGAGCTGCTCGAGTTGGCCGATATCAGCAACGCGATTCCCTTCCA
AATCTGGGAACCACAACAATTTTACAGTATTAACACCAGTACAAGATCCGTATCGATGTTTCTGTGCTTACCAACGATTCGGAGTTCCTCGTGCATCGTC
AATGGGCTGATGTCGCTTACGTTGTTGTGCTGTAAGTAGAGTTCTCGTAAATTCGTAAGCGCTCCAATGCCGTCAAGCTCGGAGATCTGGCAGTGCATCG
CCCAGAGGATGCGTAAGGAGCGAAGCGAAGTACCCAAGTCGCGGAAGCTACCGACACAGCTCTGCTGCAGTCGTAATTGTTGTAGAGACGGCAACAGCTC
GCCAATCACTTCAACGGATTGTTTAGAGGAATCGACCGATATCTGCAGTGAAGTGACTTTCTCTAGATCTTGATCCCCCGTCAGTTGTTTCTGAAAGATA
CAAAAACAGTGAAATACTCAATAATTAAAAATAATAATAATGAATAAAAAACTTTAACCCCACCAGCTTCTCCTGTGTGATGTCGTCGAACGGATTCTCC
AACTGTAGGATCTCGAACTCCGTTTCTTGTCCTCTGAGTTTGTTCATCACTGGAGAAAGCAGTCCGGATGCACTCGTACTTAATCCACCAGAAGGAACCG
GCGTTGGGTTGCATTCTTTCGGTAATGTCCGGATCAGGAAGCTCGTCTTGATCTCGCTGGGCTTCGGTCCTCCTGTACCCGGTTTTCTCTTCACTGTCGT
AGCAGACACCACCACATTCCCGTCCATTTCGTGGCGTAGATCACCCATCACAACCGAGCTCATGGCTACAACCGAAAGCTCTTGAGAAACACCTTCCGCC
AGCTCGCGCTAATTTAAAAATACATTTCTCATCCCAAAAGCTGAAGTCATTAATATTTTTTTTCGTCTGCAAGAAAAAAATGTACCATAATATCGGTACA
TTGTTTTATAGAAACGTCTCTTCATAATCAGTTAGCAAAACAATGGTGGACAAGACTTCGCCGACTTCGACTGCGCGTCCGCTGGGTACGACGCCGTCCC
TGGGCGCCGCTAGAACTGCTCGTGCTTCTAAACCTAAAACGGAGTCCAATGCGAAGCCATCGCTGGTGTTTTTGCGGCTGAAACGCAAGCGTACGGACGA
CCCGATGGAGTGTTTAGTGGTGCACAGTGAACCGGATTCGAAGCGCTCCAAGGCATCTACAGACCTGCTACAAGCCTTTACAAAGCTGTCGACCACTGAA
AAGCGCTTTGTGTTTAAGCATATCGACACAATGGAGGAGCCTATCGCCCCAGGACGCGTCAAGTGGACCGAGAGGCTCAAACGCAAAGCTCGTTCTCTTA
AAGACGAGCGTGCCGACATGTTGGCCAAGAAACAGATCGCCCCAGTGTTCCAGAAGGACCCTACAGCCTCTAAACAGACGGGAAAATGGGTCCAACAGCA
ACATAGTCGCTCTAAAGCGCGACGGAAAGAAGAAATGCTCAAGTCCAGAGGTCTGCAGCCGATTGTGGAGATTAAGGAGAAGCAGACGATGGAGCTGCAC
GGCATTCGACTGGTAGATTTGCAGGTGTCAACAGCCCCAAGTACGGAACAAACGAAGAACGAGAAGGAGGAGGAGATTCTGGAGAAAAACAAGGCGGATG
TCGTCACTGTCAATGGAGCCAGACTGAAACCCACGAGAGTGCTGAACCCGCACGAGCGCGAGCTGGACGAGGCCATTTGGACGGCTTTTCGCGCCAACGA
CTTTGCTCCTTTCTTCCAGATTTACCATGCGCGGCGGCCAGAGCTTCGTGCGGACCCAACGACGTTTCAACGACCAGCAGATGGAAGTACCGTCCTCATG
GCGGCGGCACTGCACGGACGCAGTGATGTTATCGAGGTGCTATTACGCGCTGGTATTACGAGTGTGCTCCAAGAAGATTGGGAAGGAGCTACTGCTGCGA
TGTTTGCGAAGCGTGGCGGACACGCTAATGTGGAGACTGCGCTACTTGCGTGTGAGGAAGCAGAGCATGAAAAGGATTACGTCTACGATGTGTACTGCGT
CGATATCTCGGCAAGTGAAGGACAAGACACCGCTGATGGCACCGCTCCCCACGCTGAAGGTAATTCGGAAGCAAAAACAAGTGTAAACGGTGTGCCGGTT
GTCAGTGTGAGCTCGGAGGTGCACCGATGGCTTTCGGAAGACGCAGTGAGCGATGAGGTGGAAGAATACATGCTGGAGTCGGACATCGATAGCAACGATG
AAGTTGACGGGTACGCTTGCCTGTATAGATATCCGTGGGACCGCTGAGGCGTGAGCGGGACCGATCTAAAGATCATAATTCTGCGTTGTTTTGACGCTTT
CTGTTGCTTGTGGCTTGCCTGCTCTGTAGATTGAGCGAGGACTCCAATGACGAAGACAATGCCGCGAACGACTACCCTGACGAAGAGTCATCGGACGAGT
CTCTGGCGGACAGCGACGACCTTGACGAGGTACGTGGTAGAGCTTTACTGTAGTATTTTCGGATGGGATTTTGATGGCATTTCCGTGTCTTTACGTTCGG
CAGATTGGGGCGAGACGTCGTTGGCAAAGTTCCGAGAACGACTACACTGAGCGAGACGACTTCGACTATTAGATGACTGTCGTTGACAATGTCAAAGGTT
GTGTAGGTAGTGATTGGAGATGGAGATGGAGAACCAAAGCTTCGTGGTCGTAGTATTCATGATACCGGTACGCAAACATACGAGCAAAGACACTCTAATT
GTTAAATGGTAAAAATCGTGGTTTCCTAAACAAGTTTTCACGCCGAAGTTTTAGAACAGTGAGTACGTTACCATCGATTCAATCCTTTATTGACAATCAT
TTTCACTCCGGCATCCTCGTATCTATACGAATTGGCTGCTCCAGTCGAGTCCATGACAATAATCGACGCTTTATCTACGAGCGGTAGTCGGCATTAATGG
CCACGTACTCGTGCGTCAAGTCGATGCCCAGCACCTGCGTCTCCTCAGATCCGACACCCAAGTCAATCTCCATCTGCAATTTGAAAACGAAACACGTTAG
AATGGTACGCCCGAGTTAGATAAATGAATAACACACTTACCTCGACAAACTTTCCGTGCGGCGGGTAGTTGTGGGAGCTGGCGTCGAGGCCTCCGCGCGT
GGGTTCAATCAACATAGCGTCGCGCATGTGCGCCACAAGCTTGGCCTCAATCTCGTCGTTGAGCACCATCTCACCGTTCTCGAAGATGAGAACGCCACCC
ATCCAGATCTTCATGCGACGCTGGATGTTCACATCCTGGTGGTGCAGACCCATGTACTTGCCCACGGCCATGACCAGACGGCCCACGTTCGGGTCGTTGC
CAGCCACCGCGCACTTGAGAAGCGGCGAATTGACCACCGACTTGCCCACTCCCTTGGCCATTTCTTTGGACAAGGCGCCACTCACACGCACGCGCATGAC
GTGGTGGGCGCCTTCGCCGTTGCGCACAATGTCCTCGCTCAGCCCAAGACACACCTCATGTAGCGCCTTCTTGAACTCGTCCAGCTGCTTCAGGTCGAAC
GGGATCTGGTCGGACGAAACGAGCGTCACCGTGTCGGACGTGCTCTGGTCGGTGTCCACACTGAGCGCATTGTACGTGTCTGCCACCACCTCCGTCAGCA
GTTGACGCAGCACGTCACGCGGAATCGATAGGTCTGCGGCAAAAGTCGAATTTCAGTTAGTTCGCTAAAACTATACCCTTTCATAGATGCTCTGCAATTA
CCGGTGAGGATGTAGGACAACATCGTAGCCATGTTGGGCTCGATCATACCCGCACCCTTGGCAATACCAACGATACGACCGCCGCACACGTCCATGGAGC
GGATCTTCGGGTACAAGTCTGTCATTAGCACGATCGTAAGTGGTTTTACAGCTCCTTTCACCCCTAAAAACCAATATAACTCACCAGTGGTCATAATTCC
CTCAGCAGCAGGAAGCACCGAGTCGGACTGCAAGTTGTTCACGAGCTTGGGCAGGTTCTCGACCATAGCGTCGACAGGGATACGCCAACCGATGACGCCA
GTGGAGCATGGCAACACTTGTGTGCCTCCCTCGAGCCTCAGGTGCTTGGCCAGGTTCTCACAGACCTCCTCTGCATCAGCCACACCGCCACCGCTGGCAC
AGACGTTGGAGATCTTGTTGTTAACGAGGATAGCGCCGAGTTTCGGCTCGTTCAGACGCTTGCGACCCACCAAGACAGGAGCTCCGGGGAATGCGTTTTG
CGTGAAAACGGCAGCAAAAAGCGACGTGGGCTTCACGGGTTTAATCAGAGTCATCGTCATCTTGGCCGGGAGGTGGGGGGCTTCCTGCGGCACGAAGTCG
AACTTGGTGGTAGCAACGGAGAAGCCCCAGGGCAGTCGACTCTGGTGGGCCTGCAGGTAGTCAATGTACTCATGGCGAGACTCGAACACGAACGGGTGGC
TGTGGGTGGACAGGCAACGCGAATGCAGCAGCGAGCGCGACCGGGTGAGCGTCGACAAGCGCAGGAGCGTCATGGAGTTCGTGGGGATCTAGGGGACGTC
GCTTCAATTGTGGACCAGTACTCGCGGTGTTAAAACGCTGTGTCACTAGGATTTTTCATGTGGCCGTTGTGATTCTAATCTTTTGTTTACGTTGAAGCTT
TATGTATCCATGCCACAAATTTTGCAATTTGTGACCGTCCATAGTTAAAAGGGTCCTCAAAATGCCGCACGAAGACGGGAACGAGTCGGAGGCGACTTCG
GACGCGCCTTTGCCTCCGCCTCCTCCGCCGCCTCCTCCCCCTCAAGACGAACTTAAGAAGAAGAAGCCTGTCAACCCCACTCAGACGCTGAAGCCCAAGA
AGAAGAAGGATTTCCGCGAACTCCTGGCGCTTTTCCACGAGGAGTCCAATGACACAGCAAAGACCAAGCGCCTGTGGACTTCTCTATGGCAGACGACGCT
GACTGAGAGCCAGGAGGAGCACAAGAGGCGTAGGCAGCAGGAGCAGCACGGACTCAAGCGCAAGAAGAATGGGGAGCACGACCACGGGCCCATGTCGGTT
CGAGGCGGTCCTGGAACTCTCTCTCGTCACGGCAGCATGACCCAGGACCATCTCAAGAGAGCGCGACAGGTGCGATACTGCTCACGGTGTAATCCGTAGA
GAATTTGGTGGTGTGGGTGAAATTTTGACGTTGTTTTTGGTGATTTTCTTAGGGATCAACTGCGAGTACAGACTCGTCCGAGTCGGGCAAAGGCAACCGA
CTGGGTGGTCGCTTCCCTAAGAACGTCCCGAAGGGATCCAAGCTTATGCAGAAGTTTGGCGGACGCACTTAAGCTCGAAATGTGCGTAATATTAACTGTA
TTGAAGGTTTCTAAGCGGGATCGACGTTTACTTGACCCTACATATAGCTACTGAAGCAAGTTATTCAACTCGACGGAGACATCGAAGTCCTCATTGGAGA
TATCACCGAGGAAAGCATCCAAATTGCAATCCGATCGCACCTTGGAGGTCTCCACTTCACAGAGCACGGCCTGTAAGTCGGCTTCGGTTAACAGACCAGC
ATCTACCACCCCGTAGTCAAGCTCGAAACCGAAGGTCAGCTCCAGGTCAACATCCTGGCACATGTTGGCACCAATGTCGATGTTACTACCGTTGTTGTTG
CTGAGTTCAACAGCAACTGCCTCAAGTGGAGAGGCCGCAGTGGCGTCCCAGTTCAGTGCTGCCAGTTCGGCCGAGTCGAGCACGTCCAGAAGCAGCATGT
CGTCCGAACTGTCGCAGTTGCTATCCTCCTCTTGTAGCCACAGCGACTCCAAGACCGACATGCTTGTGACGTCAGACAGTTCGTCCACGGCGCACACATC
GCGCGGGGACATCTTCTGTCTCTTCACCTCGACGACGTGTTCAGTGGTAGCTCCGGTCGAGAGAAGACTCCTCGGTCGCTTAGTTGATGTTGGGGTCTTT
GCTAGCAGCATCCTTGCTGCCTTCTGCTTCAGCTTCATCTGAGTCGCCAAGACATCGAGCTGCGACAGGTGGCACCGGACGAGCACGTCGTGGCTGAACG
TGGCGACACTGGCGCGCGTCTTGGTCCACTTGTGGAAGCCGAAGTTGTTGAGCTGGCGCTGGAAGCTGGAGAACTTGCCGTGCTTGAAGTACTTGCGCAG
CACCTCGGTCTCCAGTCGTGGTATGTCGTAGACCTGGAAGTGCGATCCGTCGGCTGACCACGACAGGATGCGCTGGTCTTCGTGCTGCAGCATCTCGTAG
ACGGCGCGCACGAAACGAGGCGCACTGGCGAAGATCGCGTCATTAGCGTTCGTTGGCGTGGTATGATCCATTTTGCTGCTTGTGTAGCTAGTTTTTTGCT
AGAGTGGTTGTAGTTGTTTGTATGTTTTGAGTGGGTTGAGCTCAATTGAGTTGTGACGGGTAATTGTTGTCAGGCCTCAGTCATGATAACGGTGAGAAAT
AATCTGTGCGGTATTCACAACGGCTCTACCGCAGAGCGAACAGCAGCTACCAATGTACATACATCGGCGGTGAAAGCTCTTTCTCGACATCTGGTTGTGC
AGTGAAACGTTACCAAACCGCACCAGCGCGTGTATTCCTCATACGCACGTGTTTCTGCTTTGTATGCTGGCCAACAAGAGGAATACCTAGAGCTTGTCCA
ACACAACACATAGTGCCTAGCGATGTCAAGTAGTGCATGTAGTAGTATTCACTGAAAACGCTTTAACTGTTGGCGTCTTCTTGGTCCAGGTCTGAACATG
GAAAGTATAAACGTTATCTTGTCCGAAGGCCACCAAGACGTCGCTTCAACACCAAGACGTCACTTCAACACCGACATCAGTTTTCGGGGCTTCAGCTTAC
TACATGTACTAGTCAACCACTGCATCTGCTAATTCCAACAGACACCGCATGACCCTGGTAAGACCTTCGCAGCTGCGTTTTCTGCGAATTCTGCCAAAGC
ATGACAAGAAATAAAATCTTTAGTGTCGATGGCATAAATACGGCTACATGAACACTGCAGCTGCCAGGTGGAGGAGTACCGAGGTTGACACTGGTTGGAA
AATCCTCGCAATCTCGAGAACCAATGAACTGACCCTTTTTCGTGAAGGCGTCCCAGAAGCAGATAGGTG