Description :
From Genome Similarity Track
Location :
Scaffold_20:122568- 124891
Sequence
2323 bases(100 bases per row)
GTGATATCCCACTTACAGCGGTTAGTACTCCAAGCGGTATGCTTTTGGAATGGCTGGTTATGCCCCATGCGCTTTCCAATGCCCCGGCAACGTTTAATCG
TCTGGTGACGCAACTGTTCCGCCCTCACCGTGCGTACGCACAAACATATTTCAATAACATATTTGTCCATAGTCGGGCGGAACAGGGTCGGTCGGACGTG
GACAACAACATCGACCATTTAGGAGCTGGGCTCGAGTGCATGCGCACTAATAAGATATATGCTAATACATCAAAATGTATTTTTATACGGACGAGATCAT
ATTTTTGGGATGCCTCGTTGGGAAGCGAGGCCTTCAGTCAGATCCTGCAAAGGTGAAGGCCATAGTGGATTAGCGAGTTCCTATGAATCAAAATGACCTA
TGCAAATGGCTTCGCCTTGCCAATTGCTCGCACAAGTATAGCAAAAATTACGCTGGTATGGATCGGCATTATCCAATCTCCTTTAAAAGAATGTGGAGTG
GTGCTGGACTAGCACCGAAGCAGAGACTTTTTATGCCGTAAAGGGGAGTCTCCCACATGCCCCTATTTTGGCTTTGCCAGATTCTGATCGGTCTTTCAGT
GTCGTCTGTGACGCTTCGGATTTTGCCATTGGCTGTGCTCAGTTACAAACAGATGTTGGGGGACGCGAGCGTGTCATTGCTTTTAAATCCCGTCAGATTA
AAGCTGCTGAAAAGTACTAACCAGTTCTCGACAAGGAGCTACTTGCTATGAAGTATGCTCTAGTCAAATTCAGAGTTCATCTTCTTGGCTCTAAGTCTTT
TGTAGTCTATACCGATCATGCGTCTTTACGCACGGCGACCCAATCGCCTCAACTCTCACAGAGGATGGCCCGTTGGCTTTCATTCTTTGCATAATATAAC
TTCGAGGTGAAGTATAAGCCGGAAAGCAAAATACGCTGGCTGATGCGCTGTCACGATGGCCAGAATATGAGCTTGCTCATGTTACGATTTTGTCATCGTC
AATTACCGACCTAATCCGTGCATCTTATGCCAAGGATGAACAATGTGTAGCTTTTCTACGTGCTCTTGGATGCGAAGAAATTAAAACTCGGACATTAAAT
TGTCGGCACGCTCGCGTGCGATGCTAAATCGATATTCTATCGATAATGGCTTGTTGTGCTATCGCACCGATACAGCGGAACCCCGCGTATCATAGTTCCT
TATGATGAGGGACTGAAGTATCGTATCCTCTATGAGGTCCACGACAAAGCTATTAGCGGTCATCTCGGTTGTGAAAAGACCTACGGCTTGGTTAGCGAGA
GTTATTGGTGGCCCAAACTACATAAATGGGTAAGCACTTATGTGAGCACATGTGAAACGTGCCAACGGGTCAAACCCTCGGCACATGGCACTGCGCCGCT
GGATAGTTTGCCCGTACCCTCTGGGTGTTGGGAGTCCATCAGCATGGACTTCGTGTTTGGCCTACCGAAGGATTCCGATGGCAAAACAGGTATTGTGGTC
TTTGTCGACCGTTTGAGCAAAATGGATCACTTAGCGACTGTGCCGGATTCGATTGATGGTGAAAGGTACAGCTTTGCTGTTCATTGATCGCGTGTTTCGT
CAACACAGACTGCCACTGGCAATCGTCTCTGACCGCGATCCCCGTTTTACGATCAAGTTCTGGAAATAATCTTCAAGGTTCTCGGCGCCCGTTTGGATAT
GTCCACAGCGGATCATCCACGGACCGATGGTCAGACCGAGCGCGTTAATCGCTTCTTTGGCGACGTCTTACGTAGCGTGTGCACTGAGACGCCTCGGTGT
TGGAGCTCCATGCCCCCCATTGTTGATCTCGCCATGAACAATGCAGTCCATGCCTCGACAGGCTATACTCCGTTCTACGTAAACGGACTCACAAACCCCC
GCGTTTCGTTAAAGCTACCAATACGTAGATCAGGGCTTGGTGGGGGAGAGGTGGTCGATCGGCTTGCTGATGTCAGCCCTGCTACTTTTTAAAACCAGGT
TACCGCGTTCCTCACAACGCGACTGAATGTCTTACATGTGCGTGACGCAATGGCTGATAGCCGAGACAAACAGAAGGAACAAGCGGATGCTAAGGGCAGA
AGCTGTATTGAAAGTTATAAGGTCGGTGATCAAGTCTTACTAAACGCTAAAACCTACCTACAAATGTAGTGTCTGCTGTGTTTAAAACTAAGCTGCGTCC
TCGCTTCATTGGACCATTCACTGTCGTGGCCAAGAAGGGGCTTGCGTATGCGCTCAACTTACCGCGCGAATTGTGTACACACCCCGTGTTGTACGTTGGC
CTCCTTAAGCCGTATCTGGATCC