Description :
From Genome Similarity Track
Location :
Scaffold_126:122530- 125766
Transcript NameFunction/comments
Phyin_T30-4PITG_20233Voltage-gated Ion Channel (VIC) Superfamily
Phyin_T30-4PITG_20234Putative uncharacterized protein

Sequence
3236 bases(100 bases per row)
ACCACGACATTCGTCAAGAAAGCTCGAAATCTCGCTCCAGATACAGCAGCCCTGTACGCCTTCCACATCGCCGTCTCGTTCGTCGGGCTCATTACCATGT
CATTCGTGCTTGGAGAGCTCGCAAGTCTCTTCATTTCGTACATCGGTCTGGAGGTGGATTTCCGTAAAAACCACATTGCCATTGAGATTTATCTGGATCG
CTTGCGTGTCAGCGATCGCCTGAAAGCTCGAGCACACGCCTTCATGACTTCTTTGTGGTCGTCACATGCTGGCGTCGACTACGAAGAAATTCTGAGTGAA
ATGCCTCGATCCATCCGGACAGCTTGTGTCCTTCATGTGTCCAAAGAACCTGTGCACTGGTTCATCAAGAAGGTAGTCGCGCCGATGTGTTGGGAGGGAT
CTGATGAGCTTGAACTGTTCCGACACAGCTTAGTGGAACACTTACACTTCGAAGGATACCCGTCCGACGAGTGCATCGTTGTCGAAGGCAACATAGCGCG
AGCGATGTACTTTGTGCTGCGAGGACATGTTCAAGCGCACAGCCGGACTTTACGCGCCCTTCAACATCCAATTGGTCTTCGTCGTGGCGACTACTTCGGT
GAACGGGGTCTTCTCGGTAGCGCCATCAGTGTCTACACTGTTCAAAGTGTACGAGCTTGTAACCTGCTCTCGCTGAGCTCTGAAGCTCTCGTTCAAGTCA
TGGGCCGGTACAAGTTCTCGTACTTGGGGCTGAGGATTTGCGAATGCGCCTATGAACTTCTCAAGAAAAAGAACCTCGTCGCTTGCTCCAGAATGGAAAT
GGAGGAACACTGGGGGTCGGCACTGCTGGAGATTGTGGACGACCTGCGACAAAGATGCCAGCAATGCATTGGAGTTGGAGCAGCCGCGAGTGTGGCAGAT
CGATTATCGTCACGAGTCCGTAGCGACGATACGCTTCCGAGTGCCCGGTTAGTGACAGGGTCGCTGACAGACCCGATAACTTGTCGACTGGAAAGCGTCA
AGGAGACTAGCGATTGTGCAAGCGACATGGTCAGATCTGACCCGGAGATTCAGCCGGATGGATTGCCGAAGAACGTGGATAAGATGTTCGACGCGTTGAC
TACCACCACAGACTGCTACAAGGCCTTCTCACCGCTGCTGCAGATTCTGATGCCGAGTGATCCCCTCGACTGGAAGGCTAGTCGCCGCCGTGACAATACG
GCGTTTCACGGAGGGAATAAGGTGGCACCAGTGACACTGGGCACAGGGGCTTGGCTCAGCAACAGGCATCTTGAAGCCCTCGCCAAGACAAGCCAAGCTA
ACGAGGTGGACGCAGACGACGTTCGTCCTGTAAATCTTCAGCAAGAGCAGGATAGTAAATCTCTCGAGACAACTCCTGGTGGGTCCGCTCAAGCAGCTTC
ACTCGTCTCGCGCATTCGTGGCGTCAGCGCTGCAGCGGAGAAGTCAAAACCACGCGAAAAGTAGAAAACTTGAGCATACAAAGCGCGAACAAGAAGTCGA
GAAACGCGTTGGCCTTCGACAACGAGAATACAATCAACCACAATCAACCCTCCAGCTCACGTGCTCCGTAAACGCCCCACAGGTACGCCCCCCCCCCTCT
CCCCATGTTTCCTTTTGAGCTTTTAAGTCATGCAAACCTTGTGCTTATCTTGTATTTGTAGGCGATCTGACGTATTCCTCAAGCAAGTTCAGATTGTTGG
AGGATGCAGCAGACACAGAGTCACTGGAGTAACACAACGTAACTATGACGTCGTGCACAGCGTATGGTAAACAATATTGCATAAATATTAGTAGTACGTA
AGTAGGTACTTACTTACAAGTAAAGTTGGTGCGTTGCCAGCAGCGTAAACTACCCAAACAGCGCGAACAGTGGTGCGGCAGCATTGCTCTCCCATCTCAG
CAGCGCCATAGCGATCTGGTACTTCCAGATCGTGGCATGTTTGGCGCTTCGACTGTTGAGCAGATTGCCGCCAAATGTTACGTCGCAGCCCCGCTCAGGT
GGCCTGGGTGGGCCGATAATACCTGCCGGGTCAGTCTCCTTGACTGGCGGGTCCGTGATCAAGAGCCAGTAAAACATCTCCATCCACTGCACATTCGGGT
CGTCGTCGTCCTCGACGCGCACAGCGGGGTTGTGCGACCGGAAGCAAATGAGGTAGCCATTTGGCAGCCGGATGCGAAAGAGGAGGAAGACAGTGCGGAA
GATCGGAGCCGAGCTTCCTTCCTGGAGATCTCGTCGTATCAAGAGCGTATTGTCGTTGATTCTCTGCAGGATCTCGAGCTTCTGTACGGACGAGTAGATG
CCGTGGTAGAGTCCAAAGTCGCAGTACATTTCCCAGCTCTTGTGCACCAGTTCCTCCGTGCCGATTGTGTCGATCCTCTTTGTAAAGTTAAATTGCACTC
GACCGTCCGCCGTGATACGCTGGTGCTGAGTCCAGCCCATGGTCTTCTCCTCCTCTCCAGTCTCGACTCTCTGCATCGTCTCAAAGAAAGATGTCGCCTG
TCTGTGCGAGTCAATCATAATGTCTCTGGCTTCTGCCACCGTCAGCCTATGGAAGTGGATCGTGCCGATGGACGTCCGTATGCCAACTTGTCTGGGGATC
TGGAAATCGTCCTGTAGTCTCTGCAGCTGCTCGCCCAGTGCATCGTAGATAAGGAACTGGTCTTTGAGCTCCGAGTTCTCTCGACGGAGTCCGCGCACTT
CGTAGATGGAATGCACAAACTTTTTAAACAAAACGTCCCGCAGACTGCGCTCATCGAAGTGCATCCAGTCGTTCTCTCTCCTGTACGTGGCCAACATGTT
GTCGAGTTCTTTCTCGAGCTCGTCGTTCACCTGGCGCAAACCCTTGCGTTCATTCTGAGGTCCAGAAATTAAGCTGTCAAATACAGTTTAAGTAACAGGA
TAAACCAGCCGCACCCACCTTCTTCCGCACACGCGACTGGCGCACTATCTCGCAGTGCTTGAGCCGCCTAAACTCGGCTTTGGCCATGCGGCGCTTGGTG
TCTGACGGCAGGTCGGGCGTCAGCTCCACGATTCGGCGCTCCACGTCGTCTAGCGTCACTCGCTGTTTAACAGAAGGCTTATTAGGCCTCGTGACCAGAT
CGAGCGTCGTCTTCGTCGCGGTGGGGGGAGGAGAAGCGGGCGACGCGTCCAGCGAGTTTAAATGCGCGTCAGGCGGCGGCATGAGCGGCGGCAGGTGGAT
CGGCATGGCCTTACTGAAGGCAAATCTGCTTGTTAT