Description :
From Genome Similarity Track
Location :
Scaffold_237:12251- 14974
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_237-fgenesh-gene-0.2Pro-apoptotic serine protease nma111
Pytar_ATCC12531maker-par_contig_237-fgenesh-gene-0.0TRNA pseudouridine synthase

Sequence
2723 bases(100 bases per row)
CGAGGCCTTGGTCGCCACCTACATGTCCATATTCATTTCCCCCGTGAGCATCGCTTGTCCATTCTTCACGGCAACTTTGCCGCCCCCTTTTCTTTTCTTT
TCTTTTTTTTTTCTCTCTCTCTCCCTGTCGCTTTAGTCGTACCGCTTCCTCGCCGCACTTTTCACATACGGTGGCTTCGACATGGTCGCCGCATCTGCGT
CAATAAGAAAACGGTGAGACTCTTATTCCTCCCTCCCCCCCCTCTGGATCCGCTCCAACTCCACCGCTATGGACGCACTTTGGACAGAAGCCTGGCATGG
CTAATCGCGCTGAATGGTCCCACGGGGCGGTGCTCGCTTTCTCTCTACGCGGCGCGTCGTGTCACTGGCGCTCGCGCGTCCACGTGTGTTGTGACCGGCG
TTTCCCCCTCGATCGCGCCTTCCCTCGTTTCAGCTGAACAAGGAGGATGAGAAAGCAGCCCCTTGCTTGACGTGCTGACTTGCGAGCGCAGGTCGTGCGG
CCAAAAGCAGTGCGCGCAAGTGGTCCCCTCATTCAGCAACTCGAAGCCCCCCGCTCCCCAGCTGGTTTGGCTCCTCGAAGTGTATCCACGTGCCCCCCTT
TACGCAACAATTAGCTCACGCTCCAAAACAGGGTGGACTAGAGAAGCCACGACCAGCAGGGGGATCAGAGAGAATCAGATCGTCGGATTGTCTGAGTCCA
ATAAATTGGATGGGTGAGCGGGGACGCGACGAGACAAAACGATCTCACGATGCTGCGCGCGGCGATCGCAGCGCCGACCACACGGCTCCGTGCCGATGGC
TACGCCGCAGTGCTGACCACTGGCGTCTGCGTGCGGTGCGCGCTGCGCTTTTCCAACGTCCAGGACGCCGCCGTCTACGCGTAAACGTCGCCAGAAAGAG
AGAGAGATGGCGACAATGCCACGACGTGCGCTGACGCATTTCTGATTTGGTCTCTCTGGCGTAGATGCGGAGAAGACGAACTGTATGCGGTGCTGCAGGA
GTTTGTGGGCAAGAGCGGGGCGGTGCTGCCGCCCGCTCCAGCACCGGGGGCCGGTGAGTTGACGGCGCTGTAAACAGGAGCCAGACGGGGAAGAGACTGA
CGAGGTGGACTGGACTGGGCAGTGTGCTCTTGCTGCGTGGGCGTGCTGGACTCGCGCTTCCACGACCACGTGATCGAGGAGCTGCAGCGCGTCTGTGAGA
ACAAGTACGCGTTGCCGTGTCGTGTGTGTGTTTGGGTACATGCTTATGGGACGTGTTTAACTTCTTCCTGGGTATCGCTAGCCGCTACGACGTCGATGCG
TTCGCGCTCAACATCAAGCTGCCGAGCGCTGTGTTGCTGCGTGAGTACTCGCTGCGCCAGCACTTTGGTCGTACGATCGAAGGATTCAACCGCTCGCACT
TGCCCTACGATCTCAAGGACGTGCTCAAGGTACGGTGTTGAGATATTTGGAGCGTAATGCATCGATCGAAACTGACGGTCTCTTTTGTAGCTGCTCGTGG
TCAAGCGTGTGGGCGAGACCATTGGCGTCACGACCTGTGAGATTCGCGCCGATTTCGCCGTGCTGCTAGACGTGAGCCACGAGCAGTCGGCCGACGAAGT
CCAACAGATCCCGGCGATCAAGGTGCCGTAATAGTGGGGCGGGGGGGGACTCCTCACGCTCGACAGTACTAACCTTTAGCTCATCAATGCTGGTAGAATC
AACTGGATGCTCAAAGCAGCAAGAAGCGCCACCGCGGCCCCGCGCCAATCCTCGATGGCTTTGGTGCCGTCAACCGTGCACTGGCATCGCTCTCAATCAT
GCCCGACTCGATTACGGTGCGTGACATCAAATCATGATGAACATAAACTCGCAATGATTGACTCTCTATAATGATCGCAGTGTCCGCCGACGCTGGTGCA
GTCGCCGCCCAAATGCACGGTTGTGCTGGAGCGCGAACCCGTGTACTTGCAAGGACGCTACCTCAAGTACAAGCGTGGCCTCAGCCAGACGCCATGGTAC
GGAACGGTGTCTCTTGATCTCTCTCAATCTTTGTTCTCATCCGTGGTATCCACAGGGTCCTGGAAGGCCAGCGCATGGGCGAATCGTCGGTCGAGGAATG
CATTGGTGAGATTGCGCTGCCGTTTTTCCACGGACGCGGCTACAAGTTCCACACAGCCGGCCGCGAGGACGTCGACGTGCGCATGCTGGGCAACGGACGG
CCGTTCATTCTCGAGGTGCTTGGTACGGATATTCAATTGGGTATAGTATAGTATGAAAACTCCGTCCTCACATGTTTTCCCATAGATGCCAAGAAGTCCA
AGCTGACGAGCAGCGAGCTGCAGGCCGTCCAAGACGCCGTGAACGCGGCCAATGAAGGGGCCGTCGAGATCCGGGAGGTCAAGGCATCGTCAAAAGAGTA
CTTTGCCAAGCTCCAGGCTGGCGCCGACTCGAAGCGCAAGACATACTGGTATGGACTATGGCTTTGCCACGATCTCGCTCTTGGTTTTGTAGATTGCTGA
TGCCTTGGTTTCCACGGCAGTTGTGTGGTGTGGTCCCAGGCGAAGCTGACGCCTGAGGCGGTCGCCAAGCTGGACGCGATCAGCGACTTGACCATCCAAC
AGAAAACGCCCGTGCGCGTGCTCCACCGCCGCACGCTCATGACGCGCCCCAAGATCATCCACGTGGCCAAGTGCGAAGTGCTCAACGACCACTACATGCT
ACTGCGGCTCACGACGTCTGCGG