Description :
From Genome Similarity Track
Location :
Scaffold_130:12250- 17070
Sequence
4820 bases(100 bases per row)
CTGAGCGTAAATCATTTGAAGGGAAATAGGGAGAAAACCTCCTTCTCTAGATTCGAGAAGTCGAAATGGCGATGAGCGCCGCTATGCTGCAACCGAGCAG
CAGAGAGTTGGCCTAGCCATATCAAAAACTGGGCGACAGAGCCAGAGAGTGGGCTCTGACGTGTGATGCGTCGGTAGATACCGCGTTTCCCACGTGGGAT
TCGCTTAAGAGAGAGATGTCTCGCGTGCTCGCACCGCCTAATTAGGCTTATCGAGTGCTTTCATGCTTCTAATCCTCCCGATAATGGAAGAAGGAGTTAT
CGGACTATATCCAAGAGTTGGGAACTATTCTTACTGCTATGCAGTTGGATCCCCTCCCTGGGAAACTTCTTGTCACCATTTTTATGAAAAGTCTCCGTAC
TGGGGTCGCTCGGACCGAAGTTTTTCGTGTTCATCCCTCAACCTTTGAGGAGGCTGTGGACATATCGTTAAACGCCGAGTTTAATTTCAAAGCGGCGCGC
TACGGTACACATGGGCATGCCCAATATTCTTTTAATAGGGCTGAGCCCATGGATGTCAGTCATGCAGACGATGAAGAAGCCGAGCTTCAAGTTGTGGAAC
AGAAACGTAAAATCCGTAGATGTTACACGTGCGGAAGCACAAGGCATCTCCGCCCTAACTTTCCACTGCGTAAACCGCGACAGAGTCGGCCGAGCCGTAA
TACCGCTCCAAACCAGAAACCTGGTACGTAGCGGGAAAACGTCGACTCCCTGTAGGCGCGGGGCGCCCTACTGGGGAGGAACTAGGCTTTGGAGAGGCTC
GAGGAGGTAGAGCTGAACAAGGCTTAGCCCCAAACGATCTCGTGGACCTTATCACGAAGCGTATATACAAGTCAGGCTTGTTGGTTGCCTCGGCAACATT
TAAGGGCTTTGAAGAGTCGTGGTCAATTTTGATTGACTCTGGAGCATCGAGCATACTGCTGAAGCGCTGAAAGCGCATGAAGGTGATGTTATCAATGTGC
GTCTAGCAACTGGGGCCCGTGTCAACGTACCCAATGTTCCGTTGAACTTATGTGTAGAGTTTTTAGACTTGACAGCATTGAAAGCTGTCTTGTCCTAGAT
TTGGACTCGAGATACGATCTCATTCTTGGTATGGTCTGGGTTATAGGTCATGAGCCATAGATTCACTGGAGGTCCAAGAAGTCCAAGACCTTAGGCGCTA
CGCGCAATGTTTCTAGCGAAGCTTTGGAGAGTCGTGAACCCACCTTTGCTATGCAACAAAAGCACTATGGCGCGATCCTTTGACAGAAGATGTCAATGTA
CTGGACATTGGAATGTCTGAGTTAACTAACTCCAATGTGAAAACATGAATTCTGAGCGTAGCTCGTTGAGTATTGTGATACGGCGCGTACTCTGTTGAGT
GTTACTCGTTGTGATAACGAGTCACTGCATGCTGAAAGCATGGTTGGCCTAGGGCCGAGTTATCAAGGATGTGATTCCTTTGATGAGTGTGGGGTGACAC
GGGAACCTAGTGCGGTCGGCCGTAAAGGCACCACACTTAATGTCGGTAATGACATTGTTGGCGAAACGCCATTAAGTTCAGGGCTAGGCCCGTATAATTT
AAGTAGAGTGGCAGTTTTAAATCCACTACGAAACACTTCACCGGATGTCGATAAAGACATCAGCTTTCGTATAGAGGGTACTACTACTACTAGTATCCAC
GTTGGAGGGGTGTAAGGTCTCATCGAAAAGACGACCTGGACGCCAGGTGACAACTGTTAAGCGCCAGGCGTCCGTGTAGTCACATAGTGATAATAGTGAT
ACGCTATATACACTTATCAACGGAGTGACTGGCCAGGTTGAGGGCGATGTTAGCCTAGAAACCCTTCCATCTTTGAATGCTCTTTGTGAGCTAAACGAAA
TATATGATGGCGAATTTAGCCAGGCCTTTAAGACAGGAAATTTATTCGAATTAGTGGTCATTAGACCCGATGTCGAGTTGAACTCGTCCTCATTAATGAA
TGAGTCGGTCCTAGAGGACACCAAGGCGGCACTCAGTGCCCGGAGTGAATCTTCGATCCTTAAAGATCCTTTGTATCCATTCTATCCTTTGGTAAAGGAA
TTTCAAGATGTGGTGTGTCACAACCCACCATCTGTATTACCTCCCGATAGAGATGTACGTCATGAAAACGACCTAGTTCCAGGAACTAAATACTGCGTAA
CACGGCAGTGGCCCTTACCTAAGGAAAAGTGTGATGCAATCGACGATTCCTTTCGTGCTAAGCACGCGGCAGGGATGGTGCGGGAGAGTAAGCCTCCCCA
TTCCACACCTACATTTTGTGTCAAAAAGCCTAATGGTAAGTGGCGTATTGTGCACGCTTATAATAAGCTCAATGCTGCCACTATCCCGGCTCATACACCA
ATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTGGAATGTACATTGTACAGTGCGCTCGACTAAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAA
GCGATACTCCGCTAACAGCGGTTAGTACCTCGAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTCAAATTCCCCGGCTACTTTTAATCG
TCCGGTGACGCAACTATTCAGATCTCACCGAGGCTATGCACAAACGTACTTTGATGACATCTTTGTCCATAGTCGTGCAACAAACAATCGATCTGATGTG
AATAATCACATTGATCATTTACGAGCTGTGCTCGAGTGCATGCGCACAGATAAATTGTATGCAAATGTATCTAAGTGTATCTTTGGTGCAGAAGAGATTT
CCTTTCTGGGGTGCTTTATTGGGAAGCGAGGCCTTCGAGCAGACCCCGCTAAGGTAAGGGCCATAGTCGATTGGCCGGTTCCAAAGAACCAGAAAGATCT
ACGTAAGTGGCTTGGCCATGCCAATTACTTGCATAAGTATAGTGCCATTACGCAGATATGGCTCGGCCATTATTCAATTTCCTTAAGAAGGATGTGGATT
GGTGTTGGGGTAACAACGAACATGATGCTTTTCAAGCAGTCAAGAAAAGTCTCGTTCATGCGTCAATACTGGCTTTGCCCGATTTTGATCGGCCTTTCAG
TGTCGTCTGTGACGCATATGACTTTGCCATAGGCCGTGCTCTGTTACGAACAGATGTAGATGGACGCAAACGCGTCATTTCATTCGAATCTCGACAGCTC
AAAGCTGCTGAAAAGAACTATCTAGTTCATGACAAAAAGCTACTTGCTATGAAGTACGCTCTAGTTCAGAGTACATCAGCTTGGCTCAAAGCCATTTGTG
ATCTATACAGATCATGCATCATTGCGTACTGCGACACAGTCGCCGCATCTCTCTCAGAGAATGGCTCGTTGGATTTCATTCTTTACCGAATGTAACTTCG
AAGTGAAGTATAATCCAGGAAAGCAAAACGCTTTGGCTGATGCGCTATCGCGCCGACCGGACCATGAGCTTTCTCACGTCACTACGCTGTCATCGTTAGT
CACTGACTTAATCCGTGCGGCTTATACCAAGAATGAACTATGTGTAGCTTTGCTACGTGCTCTTGGGAGCGAGAAGTTTAAAGACTCGGACATAGAATTG
TCAGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAATGGCTTGTTGTGCTATCGCACAGATATTGAGGATAACCCTTGTATCGCTGTCCCTC
ATGATGAGAAGTTGAAGTATAGAATCCTCTATGAGGCACATGATACCGCTTTTTTAAGTGGTCATCTCGGTCGTGAGAAGACTTATAGCTCAGTGAGCCA
GGCTTATTGGTGGCCCAAACTATACAAGTGGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTCAGCGGGTGAAACCCTCAATACACGCGGCGGCGCCT
CTGGCTAGTCTGCCTGTACCACTGGGTGTTGGGAGTTCATCAGCATGGACTTTGTGTTTAGCCTACTAAAGGATCCGGATGCAACACAGTTATTGTGGTC
TTTGTCGACCGTTTGAGCAAAATGGCTCACTTAGCGGCTGCGCTGGATTCGATTGATGGTGAAGGTACAGCTTTGCTGTTTATTAATCGCGTGTTTCGAA
AACACGGTCTACCATGGCAATTGTCTCTGACAGAAATCCTCTTTTCACGGGTATGTGCTGGAAGTCCATCTTCAAGGTGTTCGGCACCAGATTAGACATG
TCTATAGCGGATCATCCGTAGACCGATGGCCAGAATGAGCGTGTCAATCGCGTCCTCGATGACATTTTGCGCAGTGTTGCGCTAATACGTCTAAGCGTTG
GAGCTCCACGCTCCCTGTTGTTGAGTTTGCGTTGAACAACGCTTTTCATTCCTCTACAGGCTATAATTCGTTCTACGTGAACGGTCTCACCCACCCTCGT
GTTCTGTTAACGCTACCACTATGTGGTTCAATCTTTAGTGGGGGAGAGGTAGCCCGGCTTGCTGATATCAACCCTGCTACTGTTCAAAACAGGTAGGCGA
GTTTCTCGCAACACGATTGAATGTCTTAAGACATGTGCGTGACGAAATGGCTGAAAGCCAAGACCAACAAAACAACAAGCATATGCTAAAAACAAAGGTT
GTATTGAACGTTATGAGGTCGGAGACCAAGTATTACTCAATGCTAAAAACCTACCTACAAATGTAGTGTCCGCTGTCTTTTAGACAAAGTTGCGTCCGCG
CTTCATTGAACCATTCACGGTCGTTGCTAAGAAGGGACTTGCGTATACGCTCAACCTTCCACGCAAATTGCGCACACATCCTGTGCTCTACGTTGGCTTG
CTTAAACCGTATCGGGATCC