Description :
From Genome Similarity Track
Location :
Scaffold_93:12250- 13417
Transcript NameFunction/comments
Physo_141022reverse transcriptase

Sequence
1167 bases(100 bases per row)
GTCAATGTACGAGCTCCGTCCTAGGACAGGGCCCATCTGCATCGGCGCCGGGATGTTACGTTGGAACACAGTCATCTGGTCTGTCAGCGCGGGTAGACGT
CGACCAGACAGGATTTCGTCGTCCGATCCGGTGTCGCTCCCTGCGACGTTGTCCTCTTGCGGCTTAAAACCCAGATAATCCAGTACGTCCTGATCCACCT
GAGCTTCCTTACCAGGTGGTAGTCGAACAAAGCCCCACAGAGAGTTGTTGAGCATCTGCTGGTACACCAGCGGGGCATTCTTCAGACCAAATGGCATGCG
TCGCCACTGGTAGTAACCGAATGGCGACACGAACGCCGAGATGAGCTTGGCTCGCTTCGTCATCCTGATCGCCCAGAAGCCGCTGGCCATGTCCAGACTC
ATAAACCACATCGCGCTCTCGAACCCGATTAGCAGGTCGTCAATGAGCGGGAGAGGGTAGTTGGACAACTGGATGAACCCGTCCACGATCCGGTAATCAA
TGCACATCCGGATGTCGACCCCGTTCTTCTTCAGTACCATCACGATCGGTGACGCCCAGGGTGACGTAGATGTCTCGATCAATCCAGTCTCCAACAACTT
CTTCAGCAACTCGTACACCTTCATCGCAAGGTGTGGCGCGACCGAGCGTGCCCTCTGTGTGACAGGCTTAGCGTCTCCCACATCCAGATCGCAAACGACT
CCGCGAGCTGGGGCAGGTGCCGCATTTCCATCACCTAAGAAGATACTTCGGTGGTACCTCAGGATGCCACGTAATCGGTGTTCGTCATCCGGCGTGCTCA
CGCCAGGTTCGCCAACATCAGCCTTGTCAATGTCGCACTCGGGACTTAAATCCTGCACCTCCGGGAGGAGTGCGAGTTGGTCTCGCAGCTGGGAGAGCAG
ATCGCTCCCTTCATGAATGTACACGGCTGGTCAAAGTCCAACTCCTCCACACTTAGTCGCATCACCCGCTCGTACTCTTCTTTGAGTTTCTGCACCGGAG
TGCAGGGCAGGATACCGGATGGTAAGTCGGAGACATCCTCGTCGGTCACATCTGGTGCGTCTTCCGACACTTCGTTTTCATCCGGTGTAACCGCGTCAAA
GAAGTCCTCGTCATCTCCATCCTGTGCAACATCCTCATCCGGTGCGACAGCCTCGAAAAACTCTTCG