Description :
From Genome Similarity Track
Location :
Scaffold_255:12244- 15989
Transcript NameFunction/comments
Albla_Nc14108750Ptype ATPase (PATPase) Superfamily putative

Sequence
3745 bases(100 bases per row)
CTTCGTGGAGACGTCGTCAGACATAATTTTTCGCGTTCCTGAAGAATGTGATAGGTGGAGGGAAATGCTATACGACGAAGAAGCTTCCATAAACAATCTC
GAAATAACGCGATTGCCGATGTGAGGATGATGAGGATCCAAAAAGAAGAGCGATGTTGGAGATGCGGCATCTCTCCCACCGCGTAAAGCACTCCGATTCG
AGGTGAACTGATCAAATTGCCCACGAGAAACCACAACGCAATGGAAATGAGTACTGTGAGTACAAATGGCCACGTGATCAAAAAAGTCTCTAGGCAGAGC
TTCAGGTTGACAATAATCACGAGATTCGTAAATACAATGAGTCCGATGGTGTTGATCCCATCCATGGTCCCATTCTGGTCGATTCCGGAAGGATTGATGC
TTCCAACAGAGTCGTGGAGCCATTTTGTGCCGTAGACAGTGAAGGCAGAAAGGAAAAAAATGACGATCGAATGCCAAATACCGTTCAGAATCCAAGGCCA
GAAGACTCGTCGTTTGAGTAATACATTCTGCTGCCCAAGAGCGTACAGAGATGGTACTTTAGACGCGCTTTCCGAAGATACGTCTTGATCAAACACAGCG
AATAGGATGAGCGGAAGGCTTGTGTACAAGACGTTAAAGCTCTGAGCTGCCACATCAACGATCAGTGGCTGGCCAGAGAATCCGCAAACAAAGCCAAACC
AAAACGTGGTCAACACGTAGGTAACGTTTTTGTACAGCATATAGCACATCAACTTTGTGACACGTCGATACGCCCAGCGCCCGTGCACAAACAACAAACG
CTGAAGAAATCGGAATTCCGCGATCGCATAGTCGGAAGCATTCACAGCTTGTGTTCCTTCTTTCCCGGATATTCCAATACCAATATGAGCTGCCTGGATC
ATCCCGACGTCATTGGCACCGTCACCTATAGCAAGTGTTACACTATTAGGCTCCATAAGCCTCACGAGCTCGACCACGTTTGCCTTTTGCTTTGGAGATG
CACGACAACAGATTACGGTGGTGCTTTTCTGAGTAATGGAATGGAATACTTTTCGCAAGCGTGGCGATAAAGCGTATTCAAGCGAGTATCCGTCAATCAC
TAACGCAAAGTCTGCACAATCGTGCCGACCTTCAGCCGACCCAAGTAGCGTTTGCTGCTCTGCAGGTACTCGTTCATGATCTTCGAACGAGTGTTGACCG
GAACTGGACGATAATCGAGATCGTTTTCTTGGTCCAGCGTTTCTGAATCGAAAAATCTGCTTGAGTTTCAGCCCCAGATGTTGCCAGAATCCTCCCTGTC
GAAGCTGAGAAGCGAAGTGATTCTTAGCCAGCCGAGCTCGAGAGTCTGAGTGTCCTTTAAACGCCCCTTTTGCGTGAAACTGAGTCGCTAGCGCATGAAG
TGCTCTTGAGGTCGACTGGTAGTCTTCCGTGGTGATCTGTTTCACAGTCATATTGTGTGATAGCAAGCAAGACGCGTGTCCGATATTGATGGCTGTTTCC
ACTTTGTCGCCTGTGAGTGTCCATATCTTCATATGTGTCTGTCGAAAGAGTTCCAGGGTCTTGGGAACGCCGTCCTGGAGCTTATCTTGGACCGCTGTGA
CCCCCAAGTAGCTCATATCTCGTTCCATCTCATCGACTATTGCGTGGACATCGGAGGTTTCTGTGCTCTGCCCAGAAGCATCTCCTTTCAGCGACTGCGA
TGCGAGGTATCGATTGTGCCATTCCTCGAACTCTTCGCGTTGTAATGCTTTATAGGCGAGACAAAGTGTTCGCATACCACATTTCGCGTAGGCTGACAAC
TGCTTATACGCTTCCTGCTTGTTTTCTTTTTGTTTATGACGATTCAGCCGCTGGAAAATCACACTATCGGCTCCTTTGCAAAGTAATAAGACGTGATTCT
CGGGAGTTTCTACAAACACAGACATCCGTTTGCGATCACTATCAAATTCCAGCGTTTCGAGTAACTTGTATAGTCGTGGGGAAGAATACCCAGGCTCCAA
AAGCACCATGGAAGTCAACGTTCGATGCACAAAGCGCACATTACACAATGCGGCTGCCGATGCGAGCGCCAACTCATCCGGTGAAGACGCCGAGTACACA
GGGACAGCAGCCGAACACGTTTCATTGAATGAATTTGTAGGTAGAAGCGTGTGGCAAAGTGCGAGATGACGCAGAAAGAGTCCAATCATCTCACTCTGTG
CGTCTTGACGACTCGCATCGGCCAAAAGCTCTAGTGGATCGAATTGGACAAATGGATTCTCAGGATTGAGGGGTGAGGCGTTTTCATCCTCCGATTGAGA
TTCCTCCAATTGACCACCGTAATTCTTATTTCCGATAAAACAGTACCGAAACACCATAAGATTCTGAGTCAAAGTTCCTGTCTTATCGGTGAAGATATGG
TGAACTCGCCCAAGATCTTCATTGAGTGCGGATGATCTCACTATCGCTGGAGAGTCTGAGATCGGGTCGTACATGGTCAAATCTTGCTGCATAAAGTAAG
CTTGCCAGTATTTTACAAACTCCAACGAGACATTTAGTGAAATCGGAACGAAATTTTGCATAATGATAAAGTATCTCAGATGTAGTCGCATTAGTTCCGC
CAATGAGAATGTCGCAGTATGACTCGAATCGTTCAAATTGATGGCGATTTCATCGTCTATATGCAAATACCAATGATTCCATCCTCTATAAAGTATCCAG
GAAGCTCCAAACAAGGCTCCAAGGAAGCAAACGGCTTGCTGGATACAAACAATGACGATTATCAGTGTGTTGAGCCTTCTTTCAACTGATGATACTTTGA
CTTGTGGGCTTTTGTTACTGCAGAAAACCTTTGTCTCGTGTCCTGTATAAATGACAATCCCAACAACTGATCGAGTGTTACGCAGCACACAACTTCGTAG
TAGCGTTTGTTTGGACGTTAACGGAACTTGAATTCGGGTGGAGTTTTCTGAATGTTGTATCACTTTATAAGTCTTCGCATCATTCCTGTCTTGATCAGGA
GAAGTAGAGGCTCTCACACCAGCTCGTTCACCTTCCGAGCGAGATACTCGAAGTGTCATGTACCCACCAAACACATTGATACGGTCGTTTGGTGGATCAC
AATCAATGGATCCCGCCAGTTTGAGCAGAAAATCGTCCGAATTCTCGCACAGTTGTCCAATTATTGGATTAGCAGTGCGAAGCTTTAGGTTTGTCTCTCC
ATCTAGCGACTTTGTTTCCACATACGCAACCGCATCGGCACACTGATTCTGATGAGCAGATTCTCTATGTTCCAATCCATCAATTTCCGTGAGAACTTGT
TCAGCGCTGCGGTCCTTTTTACTTTCAATGTATAAGAGCACCAAATCAGCAGGAATCGTCTGACCCTGATCCACACGAATGATATCACCGACTTGGATTT
CTTCCCAGTGTTTAGTTCTCCAATCGCTGGATGTATCCAGCGCCACTACCCGCTTCTGATTTGTAATTCGATCCGCCCGATGTCTCTCGCGGTCTTCCAG
CGCTTCTTTCAGCGCGCTGCATAAAAACACGACACAGAGGGGTAAGAGTATGGTCGGGAATCCATTTGTATTGCTTATTTCTTTGATCGATTGCAGCATC
GCGATAAAGAGAAAATACAGATTGCTCGGTCGTTTTAATTGGGCATACAAAACACGTGGAAGAAAAGTGTAGATTGTATATTTGGAGCTGATTACGATGT
TTGAAGCAAATGGAGAGATGGAGTGCTTTTTTGCGTTATTGTGTG