Description :
From Genome Similarity Track
Location :
Scaffold_245:12244- 14519
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_245-snap-gene-0.20Voltage-gated Ion Channel (VIC) Superfamily

Sequence
2275 bases(100 bases per row)
TGATAAGGTTTGTACTGCTGGCTTGCACATTGCTCGTACAACATCTCGACGGATGGACTCGGGTAGCTCCTGTAGTAAGTCACTAGCAACTGCACCTCGG
TGAGAGCTCCACCAAAAGTCCAGAAATGCATTGACCCGCTGCATGATCTCAGGGGGAGCATTTTGTGACCGCAGAAATGACTGAATTCGTGCTCGGGTCA
CCAAAAACTCCTTTTGCTCCAATGCAGCACTCGTGAATCGAGAATGGAAGACATCGACGAGAAGAGTAGAGAGAACCAACCCAAGTGTCATACAACTAAT
TGCAACAAATAGTTCGGTTCCGCTTTCCGGTTCAAATGTCTTACCTAAAGTTGTTAGAGTTGTCGTAGAGAAAAATAGCGACCTTGTATACTGTGATGTA
ATGAGAGTGAACTCATCCGAAGATGCATGCTGTTGCGGATCATATTTAGCACTAGGGAGCCAAGCTGTTTCTCCACCTTCTAACGTCGACGGAAGTGCAA
AGCCTTCAACTTGAGTCAAACCAAAGTAGATGCACGCGACAGTATGCAAAGCAATGAAGAGACCAACAATGATTGTTGCAGAATCGACAAGAAAAACACG
ACGAGCACGGAACCACGAGAAAGCAACCATGTACCAAGTTTGGTCTTGTGCCTCTATTGACCCGTCGTGTCGATCCAACAGTTCGCGTCGATGGCCTCGA
AATCTCCATATTCGCAAAAGTCGAGGAACGCGAAGCCAAACAATCGTGGACGACGATGAACCTGGCACCAAAATCCAGTACGGAAACAAGCACACAACAT
CCAAGACAAACCATCGGCTGTGCACATACCGCAGGGCTGTCTCAGTGGTGTCCATCAGTCGTTCTTCCGCGTCTCCCATATGGATCACTTCCAAATTCGC
CGTCACGTATAAGTCGGCCCACAAAaTCAAGTCAGCAATCGTGTTTGTAATCTGACCGTACCAAGATTCCACGAGTTTATCCCGGGTCAGGGCAAAACCT
AGTTGAAGCGGTATAAGAATCCAGTTGAGTAGTAGAACGGCTTGAACGATAATTAGCCAAAACAAaCGAAAAAGTGAGCCGAGTCTGATAGCTTTCCGCA
AGACAACTTTGGAAACCCAACGTagACGTTTtGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAC
TGTTTGGGgCAGTTTTCGACCAAGAATAAaTGTTTGGCTCCTTTTCATCACTGCCGCGGGCGGGACGTATGTTGGTGAACGCAAGAGGTCCTCGTTGCTT
GGTAGGTTTTCGTCATCTTTCTTGTCTTCATTGTCTCCGGCTTCGCTTATTCCTCCTTCGGTTCTCTCACGCTCTGATCGACGGCTGAGCATGGAGAGTT
GCTCGCGGCGAGCTATGGACACATTCTGAGCAGATTTACTCCGGCCAATTTGCGGCCGTTTAGCAGGGTCCGCTTTTTTGACAACAACAGCGCCCTTACC
CCAGATAGCAGCTCCAGGAGGTCCGGTCGATGTCGTGTGCCTCAGAGTTTTGCGCCTATTGTTCGCAGGCGTCTTCTTCGCTTGGGCAGTAGCGGTTGGG
GCTCTCGTTGAACTAGAGTTGCTGTCACCTGATTGCTGAAACAGGGTGGTAAGAAGGAACTCCTCTGGACTCGGACCTGCCGTTGATGGTGTTGGAACCA
AAaCCGAATGATGATTCAAAATTGCCTCGACAGCCCGTGCGATAATTTCTGCGTACTGCGGGTAGCCTTCGAGCACACGCTCGATATTGAACCGTGATAG
CTTGTATAATGTACAGTATGAGGCTGTGATAACCGTCGCTGATCTTGGGCGCCGTGAAAACACAGACACTTCGCC