Description :
From Genome Similarity Track
Location :
Scaffold_3:1224302- 1229626
Transcript NameFunction/comments
Phyin_T30-4PITG_02259Hsp70-like protein
Phyin_T30-4PITG_02260C2 domain-containing protein%2C putative
Phyin_T30-4PITG_02261C2 domain-containing protein%2C putative
Phyin_T30-4PITG_02262Putative uncharacterized protein
Phyin_T30-4PITG_02263Metal transporter%2C putative

Sequence
5324 bases(100 bases per row)
AGGCTCTGACTCATGCGTCCAAGTTCTTCGATCTTACGGAGGCGGACAAGGAGGAGGTGAACGTCATTAAGCTCAGTTTGTACCTCAACCTTGCGCAATG
CTACCTCAAGTTGGAGAATTACACTAAAACAGTGGCAAATTGCAACGAGGCGCTGGCTTTGGATGCCAAGAGCGTCAAGGCGCTCTATCGTCGCGCTGTG
GCCTACGAGAAGGAGAACAAGCTGGAGCTAGCGGCTGACGACGTCAAGGCCGCGCTGGCCCTCGCACCTCAGGACCGCGCCGTCGTCAAGCTCGACGAGC
GTCTTAAGTTGCGCCTCCGCCGCCAGCTCGACAAGGAAAAGAAAATGTGGACAAAGGCGTTTGCATAATCATCGACGGCAAATAGAGATAAGAATGAATG
TGGATAAAATTGCAATCATTTTTTCCTAACAACATGGAATACACAGTGGCAAAACACAAAACTGCAGCTTTTTGCACAATTCGTTGCTGCTTTCACTCAC
AGCTTTTGGTCACAACACGCGCCCCATTCATTCAGGTCGTCACTGTCGCTTTGCGGCTGTGCTCTTCCTTGAGATCTTTCCAGTGGAAAAGCTAACGATT
CGCACCGACTAACATCTTCAGCGCGCTTGTATCTTCATCCCTTCCGCTCAGAAGGGCAACCTGCCACTCATCTTACTGATTGTCTGGAGCTGTGCATCTG
TTGATCCACTTGCGTCGTCGCACCATTGCTAATGTGAAGGGATCCTTCTGCCAGGGTCCGGCGAAGGACGGCGCGTAGATCCAGCCATTGTCGTCTCCCT
GCGATACGTCGAGGGTCCATCCTTCAGCCGTGAGATGACTCGGCACCTTAGGCGCAATCTCCTCAAAGGCATTAGACGTGATATTAGCATCCGTGATGGA
GCTCCAGCGTTTGCGTTCGGTAGAGCCAGATATGTGCGTGTCTGTGGTCCACTTCTTGACAATATGGTAACGCTGGTTCTCCCAGAGCTCTAACACTTGG
TCCACTTGCTCGTTGGGAGTCACTTTGATCTCCAGGAAGAGCACAGACTTGCGCTTCTGCTTGTCGTAGTCAGGAGGCACCTCCAGCTCGTAAGACACGA
CTTCGGACTGCTTCTTCTCGAGGAATGGGGCCAGTGCAAGGTTGGCATTGCCAATGCAGTCATCTTTCATGAAGCGATCGTAGTCCATCACGTGCACTTC
GAGGCATTTCTCCTTGGGGCGGTCTACTTGGAACTGGAACGTCTCGGCCGGTTCCCAGCGCGGGTTGAGGCTGCTCTGCACTACCGAGCTCTTCTGGCTC
ACGCGCCCCACTTTGAATACCACGTACGGGTCGCTCTTGCCGCCCATTCCCATGAAGCCAAAGTCACTGGCCGCAAGGTCGACTGCGCGTACCAGCGTCA
CCTGCAGCGTGTGCATGCCGCTCATCCTGTAGTCTACGGTCTATTCCGCTGTCTTCCAGATCCGGAGTGCGACTGACAGTGTGCGTTGTGGTGTGGTATG
TTGCCTTCTCGTAAGAATGAAGTATACATGGGAGACGGATAATACTCACAAAGACAAGTGCAATTGGCGAGGAAAGGTTGCATTTGCAGCTCATTATTCG
CTAAAAATAGGATGCGTAGGCTGTGACACGAGGCTAACCCAGGCAAATTATCCGGAATATGGCAAGCATATCAGTGTATACCGAAAAGAAAGAACTTCAT
GATCACGTTTGAGACGTTTGCTTCGAGTTTTTCCTTTGGCTGCATTTTGCGTACCCGTCGGTATTGCATCCGATATAGGAAAGGGTCCATTATTTTAGTA
ATAACACTGAAGAAGTCGCTACGAGCGCTGCAACCTGAATGCATGCAAGCCGATGGAATCAACATCGCTTTCGCCGTGCGTCTGATTTCCTGTCTCACAA
GTGCGTGTCGACCGCACGTTAGCCACGGATAAATGACCAAGCGCGATTGCGGACGGGCACTGTGACAAAATTCCATCGCAAACGGCCTTTATCATAAAGT
TTTTGAGGCAAAAGTGGACAGTCGCCGCTGTACCTGGATTCGCACTGCACACGTACAAGTTGAAACGCTGGATATTGCGCTGCATCCGCCAATGTGTTTT
TCTAGAAGATCGTCGCCGTCTATCCACTGATCAAGTGCCGCATCAAGTTGCCTTTCATATGAGAGCAGGATGAAAACTTGTCAAAATCGTTTAAGTTGCT
CGTCTTTCCGCGTATCCGTTCACGCAACATAGTTCCCTCTCTTTCATTTCTGACGTTGTTCACTTGTGAAAAGCTCCCGAAACGGCATCCGACACTTCAT
TCCCCCCTTTTTCCAGCTCTCGCAACGCAATGTACGCCGTGCACGTGACACTCGTCAAGGCTGTGGACCTTCCTTCCGCCGACTTCAATGGCAAGAGCGA
CCCGTACGTTGTTTTCCAGCTGGCCAACACGACGCACAAGAGCTCCATGATCCCTGCCAACCTCAATCCGGAATGGGACCCGGAAGAGACGTTCGCCTTC
ATCGCCGACGACCCCACCACCGCTGTACTAGAAGTGAACGTGTTCGACCACGACCGTATCTCCAAGGACGATAAGATCGGCTTCTGCCACGTGCCGCTCG
CCTCTATCCTGGACAAACCCGAGTCTGAAGTGCTCATGTACGAACTCGAAGTGCCTGCTGGTTTTGCCAAGCAAAAGCGAAAGAGCGCCATTATGCTCGA
GATCAAGCTCGAGAAGGAGGACTAGAAACCGACCAACAACAAAACAAGTTTTTTTTTACTGTTTGATGTCCAAATGTGGCAGTTAGTTGCGAACTTTCTA
GCTCTGAGACTTTGCGTGGAAAAGTGCGCGTGCTAGTTGGTCACTTCTTGTCACTATGACAGCCACAAGCATCCGGGACAAGACGGCGTATTTCTCTCAT
TCTATTGAGTTTTTCCCACCGCTAGAAAGACGTCGTGGTCGCAAACCATCTCTCGTCCCGCGCGGCGGCTCCCAGGGCGCTTTCCGTCGATGGTTCGGTG
CCTCCATCGGCTTGACGGCTGCCACGCACGTCGCTCCACTCACTTTTTTGGCAGCTTTCTTGCAATCTCCCCAGCCTCTTGGCAGCTCGACGGACGTGCT
TCATTCCCCAATCCAACTGCAAACAAAGTGAAGTTCAAAGTTGCCGGGAGGATGAAAAAGGCAACCAAGGCCTTGAGCAACAAAGAAACCAAGCCAGAGT
TTCCGAAATTTAGTGAACTTCTGCACGCAGCTTCGCATTCTTCCGAAGACCTCGACATCATCGACTCGTGGTCGTCAAGTTCGGACACGGACGAGCACGA
TGCGGAAGAGTCCAACACGGCAAAAATGTGCCGCTACTCGAGATGCTCGAACGCAGCACGTAGTCGTGGACTGTGTCCGGCACATGGAGGAGGAACACGT
TGCCGTATCCAAGGCTGCGTGAAGCATGTTGTCTCTGGAGGTCTGTGTGTGGCTCACGGTGGCAGTCGTCGTTGCCGTGGCTCGCCTAGTTGCTCTAGTA
CTGCTGTGAGTCGAGGACTGTGTGTGCAACACGGTGGCGGACGCAAATGCAGTCACGAAGGTTGCAACAAGCACGTGGCTTCTGGTGGCTTGTGTCGAAC
TCATGGAGGAGGACGACGTTGCCAAGTGCAGGACTGTATGAGTAGTGCTCAAAGTCGAGGACTTTGCTACGTCCATGGCGGAGGAGGACGTTGCCAACGT
GACGGATGTGGCTCTAGTGCCAAGAAAGGAGGCTTCTGTATCGCACACGGTGGAGGACATCGCTGTCAAGTGGACGGTTGTACCAGTAGTGCTGTGAGTG
GCGCTCGATGTCGTGCACATGGTGGTGGACGTCGATGCGCAGTGGACGGTTGTGCGAGTAGTGCGAAAACTGGCGGTCGCTGTATTGCACATGGCGGTGG
CAAACGTTGTACCGTGAGTGGATGTACCAGTAGTGCTCAGCGTCTTGGACTGTGCAAGGCTCATGGCGGTGGACGTCGATGTGTTGTTCAAGACTGTGCC
AATAGTGCTGTGAGTCGTGGTCGCTGTATTGCTCATGGAGGAGGTAAGCGATGTGTCTTTGAAGGTTGCACGACTACGGCTCGTAAAGGAGGCTTCTGCT
TTGCACACGGTGGGAGATCTACAACTAGCAAGAGTAAGATGACGTCTCCAGTCGCTGCCAAGGCTCGTACGTGGTCTGCAGCTCACTCTCCGATTCCAGA
CCTCAGCTTGCCTCCACGTAGACTACTGCCTCCGATTAACACAATGTTGATCGCTAATCGCCCCGGTATCCTTCGCCGTAGTACACCGATCCCACCAATC
CGAGCGCCAATTATCTCGTTCCAGAAAGACGAAGCGAGTCGTGAAGCTTTGCCAGTGGCTAGTTGGCAACTGAGAGCTGCAGACCAGACGACGTATCAGC
GCACACCGCAAACACCGACGTCGTCCACGCGTGCTGGTTACTCGTGGCAACGACTTCAAGAGACGATCCGTCGTGAATCTCGTGTCCACGGCCTCACAAA
TGAAGACGAGGAATCTGCATATGAAGACAAAGTCGCTTGCAAAGTGGACGACCACGAGGTGCAGGACAGTGATGGCGCCTTTTACCGGACTCGAAGCCGT
GGCCCAATAGCCTAAACAAACGTTGAAGTGACGAATTTCATGTAGTGCGTAAATTTTAAGAAACAAAAAGCAAATAACAACAATTTGCTTTTTTATCTTC
TACAAAAAGCAAGCAATTTAGGTAAAAAGCTGCTCCTGGATGAGTCCAGCGGCAAGTTCATCTTCAGACGGGTCGTCAGCCTGGCACAAGTCGTCAAGGC
CTAGTCGACCGCCCTCGTCGAACTGGCGCAGCAAGAACTGCTTGCGCTCCGAGTCGTGGCTGCGATAGACCGAGACGTCTCCCTCGTCCAAAATCTCGTC
CTGCAAAATTTCTTCCAGTACGTCCTCTAGCGTCACGATACCCAGCAACGTGTGCATATCTCCACTCTGGTATTTAACGCAATGATGGCACAGTCTTGTG
AGTAGAAAGTCTAAGCGTACGCAGCTCCCCTCTTCACTTACCGCATCTGTTGTCTGGGGTTGTTTGACTAAAACTAAGTGCGCACTCTCCGATTTAAAGG
TATCAAGAAGTGCGCTCAGTCTGCAGTCCGGGTTTACAGAACGCGTCGCTCGGCCGAAGATCTGGAAGAAGCTTGCGAGGAGAGTTTTATCCTAACGATA
AAAAGCTTTAGTAATTAGTCTATAACAGCATTTGAAGTTATCTCTCACCTTTGGATCCACAAAGATGAGGTCTTTGACGTGGATAGTCCCCGTGATGTCG
CTGACGGAAGTGCCATGAACGAGA