Description :
From Genome Similarity Track
Location :
Scaffold_3:12242- 14009
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_3-snap-gene-0.28Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_3-fgenesh-gene-0.1350S ribosomal protein L4

Sequence
1767 bases(100 bases per row)
TGCTGCTGGGCAaGAAAGACGAGCTGAGTGCACTGAACAGCGCACGACGCGCAGACGCCGCGACCCTGCTGTGCAACCTGTGCGACGTGTACACGCGCAC
GGATTTAGAGGGCAAATGGCGTGAGCTTGTTAAGGTCTACGAGGTACGCAAGCGCTTCTGACGGGCAGTGAAAGGTGACTGGACTGACGATGCTCACAGC
AACGCAGGAATGATGATAACCTGCGGGAAATCCTCGATCTAAGCGCACCAAGCAAGCGGCTGAACGACCTCAATATCTGGCACTTGGAACGCATGGCAGT
CGGGGAGCTGGGTGGCGAGATGGGCCCAGCGTCCGGTGATGTCGCTGTGATCAAACAGGAGAGTCGTCGCACCAAGCATGTGCTTCGGAAGATTTTATCG
AACGGAGAGAAGTACCGAGCGAAGCGCGAAGAGGTCGTGACTGCGATGGTTAAGCAACGGGACGTGCTCCTCACAGAGCTGGAGGCTGCGAAAGGCTTTC
TTGGACAAGTGCATGCGGCGGAGAAGGTCGACCCGGAcGTTGTGGAGCTGACGACACCTGCGCCAGTCGAGAAGCGGCTGCTtGCAACGGTGAAGCCACC
AGAGGCGTCACTGAATGTCGACCTCAGTGAGGCACCGTCGATTTAGTACGTGTAGGTCTGtAaGTTGAATGCGTGAAGAAGAGCGACGTTGATTTCAGCA
TATCGAATGACAGGCCTCGGCGTCCGCCGGCCTTCTTCCTACGCTTCTGATTGTCTGTGGATCTACTCGGTGTGCAGGCGGTTCTCTAAGTACTTGACCG
CGTCGGCCGTGATCACCAGCAGGTCCTTCTGCAGGATCGAGTACACGTTGATCTTGTGCTGCGGCAGAGTGTCCACGAACGGCAGGTTGCGGGTCGTCAA
CAAGAAGTTGGTCGACACCTCTTCGCCGTCAACGAAGAGTGCGTGGTCCCAGCCGCGCGTCTCCAGGAGCTCCTTCATCGCCTTCGTCTTGTTGACCTGT
TGTTCCACAGTATTGTTCCTGTCAGTTCCTCTTCGTCTCGTCACctAGCAGTAAGTAGTGACGTACATCAACGTCGAGGGTATCGACGACGGCGAGCTTG
CCCTCACGAAGCTTGGTCGAAAGCGCGACGCGAATGCCCATGGCGCGCACCTTCTTCGGCAGGCTGTACGAGTGATCACGTACGACAGGGCCGTGCACGG
CGTAACCGCCTCGCCACTGTGGCGCGCGGATGTCACCAACACGAGCACGACCGGAGCCCTTCTGCTTCCATGGCTTACGCGTCGAGCCGCTCGTCTCCGT
GCGCGACTTGGACTTGTGGTTGCCCGAGCGGCGGGCCGCCAGTTGCCATCGCACAACACGGTGCAGGATGTCCACGCGCGTTGGCGCAGCAAAGACCGAA
CCGTCGAGGGTCACGGCGTCAACCTCCGACAGGTCGCCAAACGACAACACCTTGACGGCGACATCACCCGACGGCAAGTACTCGGCTGCAGCACAGCAAA
CGAACACCTGTCAGTTATAATGTATTCTTTTGCGCTGCGGATGGTCTCCCAGCCAGTCTTCTACACCAACGCACCGTGCTGGGCAGCCGCGATGATGCGC
GGCTCGCGCTGCGGCTTCTCCTCGGCGAGAATGAGGTTCACAGGCACGTTCTCGGCCGTGGCTGCCTGCgTTGAGGCAGCACGCaCAAGGCACGAGCGTG
GCGCCGACAGGCTGAGCGCGCCGACGCTCTTTACAAGGCGGTGGATCGCAAGCGCCGACATCTCTCT