Description :
From Genome Similarity Track
Location :
Scaffold_6:122410- 126293
Sequence
3883 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTCGCGCCATCCTACTTATCCTACCGATGGGGAGTAATGATTAAAGGAAATACTTAGAGAAATTGTAACACGGTCTGGACAACCACGGTGGCGA
GTTCTGTTCAGCTGCTGTGGATGCGTCGTCCAGCTGCTCTTTCCTGACGAGGCGCATTGGTGAAAGCTGTAAATGGTTATTTTAAAACGAAGAGTGAAAA
TAGCTTTTTAGGAGGAAGGCGGCAGAGATGAAACCACCGTAGAGACCGTAGGCAGTCGTTAGTTTCATCTTTCCGCTCTAGCGCTTAAGCTCACCACCTC
CCTGCTTCCTACCCTCAGCCTTCCTGAAGATGGTTCGCCTCTCCAGACGCTCCTTCCTCCATCTACGGCCGGAGCAAGTCGACATGGCCATGGGCATGCC
GTTCTTCGCGAAGGTACTCCGGCTGGGACCTGATCAAGTGGCATTTCGCAGCCTCGAAGGAGAAGAAGGGGTCGTGCCTCGTGTTGTGGCAGAGGATCAG
GTCGTCTTGACAAGCTACGTTACCAAGTCAGCGCGTGTGTCCTACCTACGACGAGCGGTCGCGGCTACGGGGGCGGGGTCTGTTCATTACGGCCAAGTCA
TCGCGACGGTAGGCGAGTTGCTTACAGTTCGCTCCGACTGGCAACATGTTGAGGTCGAGCTGGGGGGGGGCTTCTTTGGTGCTGCCAATCGTTGCCCCCC
TCCTCGAACATGTCGAGTTCAACTGCGCGGAGTGGACCCAAAGCGAGCTCAAAACGTTAGAAACCGAGATCGCCAATCGGGTTCTAGAACGGGGTGGCAA
ATAGATAAACCGCCAGATCCAAAATTAATGTCGAATGCCCGCGTACATACGCCTGGGAGGGCTTTGAATTTCACGTGCTCGGACCGAACCATACTCTTGA
CATAAACATTACCGGTCTTACCTTTGTGCTTGGCAGACGTCACTCGATCATGCACAAATTGTTGCTCCTCGCGCGGGTTGAAATCGTACTTGGATGCCGT
GTTTGACTTCTTGCGGGGAGAAGGTGCTGCAAGCGCCTGCGGTAGCTTGCTCTCACTGCCTTCGTGGACTGCTGCAGCGTCTCGGACGCACACCGCCTCT
TGTCGAATACTTAGAAACCGCTCTAACAGCTCCGGGTCACAGCTTAATTTCTCCACAATAAGCGCGTCCTGATCCAACGCGGGCCGAGAACGCTTGCTTG
TTTGACCAATCTGCATAGCGCCATCCGACACAGTAGCGCGCTTACCCAGCGTGGTGGCAGACCCTGCTGGTGCGCTCGCGCGCTCCAAGCTGTCTTGAGG
CGACTCATCGTCATCGCTAAACGGGTCGAAGAGCTCGTGGACCTCCTGTACTGATCCTTGACCACTGGTATTTCCCGCTCGGTCCTGCGAGAAAGCTGGT
GGCCGGAAAAACGCGTCCCTACATGTGAAGGCGCGGGACCTGCACCGCCATCGACGAAATATGCGAAGTCCAGTGCGTGTTGAAGTGTAAATTCAGCTTC
GGCACCAGTCTTCGAATCTATCCAACCACAAAGCTTCGTCGAGTCAGGAAAACTCTCATCGTTTTTCTTAGTATATGGTCATCCAATCTGCCAACCCGTT
AAGATCACATGACAGCGACGCCATATATCCTGAAGTGCCTAAGACGTTTAAAACCCTAGCAAACTTCTTAAAGCTGTGTCCAGCGTTCCTCCGCCCGACA
GAGCATCAATTTGGTGGCGGCATGCCAGGTTATATTGATTGTTGTGTTGCACTAGATAAGCACGAAAAGTAGTTCGTACTCATACCACAAGTACAGCAAC
CATGTCAAGAATGTTATGACACTTGTCTGGGAGTCTGCAAGAAGCGAGGGCGTCCGTGGCGTGGTAGTTCGCACCTCAATATTTAAAATTAACGCATACC
GATTCAGTCACGAAATATACCGATTTGGCATTTAAAATTGATTTCATACCGATTTGGTCATTTTCCCGTATTTTGAGAGGAGACGACGAAGGCGAGGCTG
ANAATGGTTTTCTCGGCGAGGAGAGATCATGGTTTTTGCTACTGGACACAATACGAGGAAAATCGAGCTCTCCAAGCCAGCTGTGTGTGCGTAGATGCCT
GGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGCCCTAGGGCTTAGGCCTTGATAATAGCGTTAATTGAGCATTA
TAGGGATTCGGCAGCTGGAAGAATCGATTCTTGGTGTTGGTTGCGCAGACTTCTATATTTCATAGAAAATCGGGAATGCAGAA