Description :
From Genome Similarity Track
Location :
Scaffold_2521:1224- 2689
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2521-fgenesh-gene-0.0Major Facilitator Superfamily (MFS)
Pytir_DAOMBR486maker-pir_contig_2521-snap-gene-0.4Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_2521-snap-gene-0.5Gene of unknown function

Sequence
1465 bases(100 bases per row)
CGTCGCCGCCAACACGGTGGTCATCCTAGTGTTCGGGGACGTGCCGTCACCTGTGGTGCTTGGTTAGCTCAAGGACACGTGGGCTCCGCTCTGTGGCACA
GTCGAGATCGTCGTTGGGGACCCGCAGCTGAACCCGGACTGCCACTTGAACCGCTCGGGACTCAACGGCGTGCTGCTCTTCGCGGTGCTCTGGTTGCTCT
GGGCTGTACTGCTCTGGGACAGCGCCAAGTTCGTGGTGCGCAAGAAAGCGCCGGAGGGGGAAGAAAAGAAGAACACCGTATTGGTCACCGAGAGCCCGAT
GCCGTCGCCAGCGTATGCTCCACGATACGTTTGCCCTGAGTTAAAAAAGCAGCGTCGCCAATAGGTGGACACGTTGTCCTTACCCATGTCACTCACCCAC
CCACCCACTGGGTGTTATCCGTACTTCCATTCAGCTCTGCGTGTTGGTGCCTTTCCGAAGTGGTCATCTGGCTACCACTGATGTAGTTCTTCTAAACTAA
ACTAAACTAAACACTTGTGCACTCACTTGAATGTTCACCTCTTGTGTCTTCAAGGCTTTCTAGTTTTCGCATCGCGTTATCATGCGCTCTCGTCATGTTG
GCGAACATCAGAGAACATTTTCGAGAGACTCGATTTTCCATAAACTCCAGCTGGCGTCCAGACTAGTCGCTGCGTCGTGACCAACTGCAGGTTTCAGCGA
TCCTGCATTGCAGTGCTCGTGTGTTGGGCTGTCCTGTCCTGACGAATCTATCAAAAGTGGAGACAAAAGTTGCTCCTCGAACGGAACTGACTGAATCGAG
ATTGTAAACATTACTCAATCTGAAATCTATCAACCACCTTAGCGGTTGTTCCCGAGCGTGCCTGCACTTCCTTCGCTGTTTGCGGCGCAAACGGCGGCTG
GCATGAGCCGCGCAAGGGATGTTCGCCTATATTTAAAACAACAATAGTCGGACAATTAAATCAACCTATTTATGCACCTTCGATTTCAATAGCTCCGATT
TACCTCTGAATCCTTGTTCCGCCGAACCACACTATTCGAAGGGTCTTGGAGGCGAAGCCCATACATTTCTCAAGATAAAGCGTTTTTTTGGCTCAGCAAA
GTCATGGAGGACGATCGGTGAGGCTTTCGATTTTGTTCATTGGCTTTCGGTGAGCCAAAAAATGCTTTATCTTGATAAGTGTGTGGGCTCAGACACCAAG
ACCCTTTTGAAAGGTGGTTAGCTCACGTCGCATTTATCCGGAGGTATTTGGCATTTATTTAATACACTATACTGTAAACCGATGGCAAATGGACTTCATA
TTCACACAAAGGATGCGCCCTAGCCACACCACAGATGACCCAAGCCAACCTGACGCCCATTGACATGGGCATCTAATGGGCGAGACCCCAGTCCCCACCA
TGAAGAAGACCCCTGGGTCTCTACTTTGGTCCCCTCCTCTCGCCTCTCGTCGACATTGTGTTGTT